ID: 965473518

View in Genome Browser
Species Human (GRCh38)
Location 3:169125139-169125161
Sequence CTCTGTGAACAAAAGGTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965473512_965473518 28 Left 965473512 3:169125088-169125110 CCCATGAATCAATTGAGTTGGAA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 965473518 3:169125139-169125161 CTCTGTGAACAAAAGGTACTAGG 0: 1
1: 0
2: 0
3: 10
4: 185
965473513_965473518 27 Left 965473513 3:169125089-169125111 CCATGAATCAATTGAGTTGGAAA 0: 1
1: 0
2: 0
3: 13
4: 197
Right 965473518 3:169125139-169125161 CTCTGTGAACAAAAGGTACTAGG 0: 1
1: 0
2: 0
3: 10
4: 185
965473511_965473518 29 Left 965473511 3:169125087-169125109 CCCCATGAATCAATTGAGTTGGA 0: 1
1: 0
2: 1
3: 8
4: 107
Right 965473518 3:169125139-169125161 CTCTGTGAACAAAAGGTACTAGG 0: 1
1: 0
2: 0
3: 10
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965473518 Original CRISPR CTCTGTGAACAAAAGGTACT AGG Intronic
900974832 1:6010611-6010633 GGCTGTGAACTAAAGGAACTGGG - Intronic
901184801 1:7366069-7366091 CTCTGTGACCCCAATGTACTTGG + Intronic
901926136 1:12567360-12567382 CCCTGTGATCAAATGGGACTCGG + Intergenic
902318657 1:15643647-15643669 CTAGGTGAGCAAAAGGCACTGGG + Exonic
905387904 1:37616848-37616870 CTCTCTGGAGAAAAGCTACTGGG - Intronic
906580593 1:46932584-46932606 CTCTGTGTACAAAAGGAAGGTGG - Intronic
906603131 1:47146308-47146330 CTCTGTGTACAAAAGGAAGGTGG + Intronic
913656908 1:120969291-120969313 TTCTGTGAGCAAATGGTACAAGG + Intergenic
914008064 1:143750572-143750594 TTCTGTGAGCAAATGGTACAAGG + Intergenic
914521471 1:148420544-148420566 TTCTGTGAGCAAATGGTACAAGG + Intergenic
914646879 1:149661026-149661048 TTCTGTGAGCAAATGGTACAAGG + Intergenic
916498161 1:165364098-165364120 CTCTGTGCACAGAAGGAAATGGG + Intergenic
917017297 1:170547271-170547293 CTATGTCCACAAAAGGTTCTTGG + Intronic
919207200 1:194432869-194432891 CTCTATAAACAAAAGGTTTTAGG + Intergenic
920715065 1:208332501-208332523 TTCTGAGAACAAAAAGCACTGGG + Intergenic
920800749 1:209185169-209185191 CTCAGAGAACAAGTGGTACTTGG - Intergenic
921214570 1:212926154-212926176 CTCTGAGAACATGAGGCACTTGG + Intergenic
922780026 1:228244645-228244667 CTATGAGAAAAAAAGGTCCTTGG - Intronic
923406391 1:233665396-233665418 CCGAGTGAACAGAAGGTACTAGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062830546 10:602570-602592 GTCTGTGAGCAACAGGTCCTGGG + Intronic
1068884491 10:62084490-62084512 CTCAATGAAGAAAATGTACTTGG - Intronic
1069864573 10:71493749-71493771 CTCTGTGAAAAAACGTTCCTTGG - Intronic
1070847185 10:79532871-79532893 CTCTGTGACCTGCAGGTACTGGG + Intergenic
1070926613 10:80227407-80227429 CTCTGTGACCTGCAGGTACTGGG - Intergenic
1071027686 10:81135968-81135990 TTCTGTGAACATGAGGTTCTAGG - Intergenic
1071211210 10:83343560-83343582 TTCTATGAACAATAGATACTTGG + Intergenic
1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG + Exonic
1072849283 10:98870469-98870491 CTCTGTGAACAAAAGGCCACTGG + Intronic
1073754117 10:106562662-106562684 CTCTATGAACAAAAGGTATATGG - Intergenic
1074397884 10:113113789-113113811 CTCTCTTAAAAAAAGGTCCTTGG - Intronic
1075373738 10:121960557-121960579 CTGTGTAAATAAAAGATACTAGG - Intronic
1078751286 11:14166081-14166103 CTCTGTGTACACAAGGTATGAGG + Intronic
1081641154 11:44755382-44755404 TTCTGGGAACAAAGGGTGCTGGG + Intronic
1083778364 11:64905734-64905756 CTCTGTGGACTATAGGTACCAGG - Exonic
1085017345 11:73183473-73183495 CTCTGTGCACACAAGCCACTGGG - Intergenic
1085028434 11:73254612-73254634 CTCTGAGAATGAAAGGAACTTGG + Intergenic
1088367121 11:109051354-109051376 CTCTGCCAACAAGAGGTGCTAGG - Intergenic
1088455602 11:110030034-110030056 CCTTGTGAACAAAAGGAAATGGG + Intergenic
1093679806 12:21988770-21988792 AGCTGAGAACAAAAGGCACTGGG - Intergenic
1094172129 12:27504569-27504591 CTCTATGGGCAAAAGGTACCTGG + Intergenic
1097193493 12:57231519-57231541 CTGTCTGAACAACAAGTACTCGG + Exonic
1098422155 12:70310202-70310224 ATCTGTGAAGAAATGGTTCTAGG - Intronic
1098520890 12:71434381-71434403 CTCTATTAACAAATGGTGCTGGG + Intronic
1100068557 12:90681789-90681811 CTCTGTAAAGAAAAGATAATTGG - Intergenic
1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG + Intronic
1105622570 13:22083030-22083052 ATCAGGGAACAAAATGTACTGGG + Intergenic
1105655976 13:22439091-22439113 TTCTGAGAACCAAAGGTAGTTGG + Intergenic
1106977886 13:35244347-35244369 CTCTTTCAACAAATGGTGCTGGG - Intronic
1108109676 13:47055437-47055459 CTATGTGAGAAAAAGATACTGGG + Intergenic
1111144102 13:84157860-84157882 CACTGTGAAGGAAAGGCACTGGG - Intergenic
1111874371 13:93874779-93874801 ATCTGAGAACACCAGGTACTAGG - Intronic
1111963633 13:94838264-94838286 CTTTTTCAACAAATGGTACTGGG + Intergenic
1114252022 14:20969791-20969813 TTCTGTAAACAAAAGTTCCTTGG - Intergenic
1115722034 14:36172890-36172912 CTCTGTGATCATAAAGTAATTGG + Intergenic
1116409561 14:44605958-44605980 CTTTGTGAACAAGTGGGACTTGG - Intergenic
1120534807 14:85681393-85681415 GTCTTTCAACAAATGGTACTGGG - Intergenic
1125863941 15:43025669-43025691 CCCTGTGCATAATAGGTACTGGG - Intronic
1126249309 15:46549013-46549035 TTCTGTGGAGAAAAGGTACTAGG + Intergenic
1129358373 15:75008063-75008085 TACTGTGATCAAAAGTTACTTGG + Intronic
1129811534 15:78514975-78514997 CTCTGAAATCAAAAGCTACTTGG + Exonic
1131042329 15:89281909-89281931 CACTGTGAACAGGTGGTACTAGG - Intronic
1131666263 15:94574029-94574051 CTCTGGGAATAAAAGGTTTTGGG + Intergenic
1131874058 15:96786067-96786089 CTCTGTGAACAAAATGGAAATGG - Intergenic
1132008102 15:98249282-98249304 CTCTGTGACCTGTAGGTACTGGG - Intergenic
1132237917 15:100235727-100235749 CTCTGACATCAAAAGGTGCTGGG + Intronic
1132297841 15:100755352-100755374 CTTTGTGAACAAATGGAACAAGG + Intergenic
1137572990 16:49578798-49578820 TTCAGGGAACAAAAGGTCCTTGG - Intronic
1137762845 16:50954542-50954564 CTCTGGGAACATCAGGAACTCGG + Intergenic
1139137425 16:64221863-64221885 GTCTGTGAAAAATATGTACTAGG - Intergenic
1140080462 16:71742282-71742304 CTCTGTGATCAAAAAATAATAGG + Intronic
1140354263 16:74291606-74291628 CTTTGTGAACCTAAGGTTCTTGG - Intergenic
1141947353 16:87319820-87319842 CTTTGTGAACCCAAGGTAATGGG + Intronic
1145715466 17:27015628-27015650 CTGTGAGAAAAAAAGATACTTGG - Intergenic
1146074761 17:29717861-29717883 CTATCTGAAAAAAAGGTAGTGGG + Intronic
1146193374 17:30790201-30790223 GCCTGAGAACAAAAGGAACTTGG + Intronic
1149003195 17:51778082-51778104 ATTTGTCAACAAAAGGTACTTGG - Intronic
1149799079 17:59549872-59549894 CACTGTGAAGAAAATATACTTGG - Intergenic
1151172837 17:72262341-72262363 CTCTGTGAAAGAAAAGAACTTGG + Intergenic
1153222173 18:2871415-2871437 CTGTGTGTGCAAAACGTACTTGG + Intronic
1154990904 18:21597620-21597642 CTATATAAACAAAAGCTACTTGG + Intronic
1155819591 18:30358115-30358137 CAACGGGAACAAAAGGTACTAGG + Intergenic
1156208432 18:34911568-34911590 CACTGTGATCATAAGGTCCTTGG - Intergenic
1159468601 18:68819321-68819343 CTTTTTCAACAAAAGGAACTAGG - Intronic
1168595862 19:57676229-57676251 CTCTCTGAACAGCAGGTCCTTGG - Exonic
930743851 2:54860901-54860923 CTCTGGGAGCAGAAGGGACTAGG + Intronic
931125984 2:59276843-59276865 CTATGTAAAGAAAAGGTATTTGG + Intergenic
931680705 2:64747281-64747303 TTCTTTAAATAAAAGGTACTGGG + Intronic
932169099 2:69537506-69537528 CACTGTGAATAAAAGTTAATAGG - Intronic
933344041 2:81060843-81060865 CTCTGGGAGCAGAAGGGACTAGG - Intergenic
934521452 2:95022645-95022667 CTCTGGGAACACAAGGAAGTGGG - Intergenic
934983279 2:98865362-98865384 TTTTGTGAACAAAAGGCACAGGG - Intronic
935393471 2:102580142-102580164 CTTTGGGAACAAAAGGGACTAGG - Intergenic
937496256 2:122423289-122423311 CTATGTGCACATAAGGTACCCGG - Intergenic
937738643 2:125321425-125321447 TTCTGTCAACAAATGGTACCGGG - Intergenic
940881275 2:158949286-158949308 CTCTGTTAGCAAAGGGGACTAGG - Intergenic
943497812 2:188646240-188646262 CACTGTGAATACAAGATACTTGG - Intergenic
943960557 2:194257283-194257305 CAGTGTGAACAAAAAGGACTTGG + Intergenic
944037164 2:195308968-195308990 CTCTGTGACCAACAGGGACTGGG + Intergenic
946510893 2:220355116-220355138 CTCTGTAAAACACAGGTACTTGG + Intergenic
946739116 2:222784737-222784759 CTCTTTGAACAAATGGATCTAGG - Intergenic
947047085 2:225999886-225999908 CTCTGAGAACAAAGGCTCCTTGG + Intergenic
947661183 2:231869836-231869858 CTCTCTGAATAAATGTTACTTGG - Intergenic
947738566 2:232473920-232473942 CTCTGTGAACAGAAGGGACCAGG - Intergenic
947877362 2:233476661-233476683 CTCTGTGATCAGAAGGTCCTTGG - Exonic
1168798861 20:631062-631084 CTCTGGGAACAAAGGGGCCTAGG - Intergenic
1169197728 20:3692502-3692524 CTCTGTGAGCAGAGGGTCCTTGG - Exonic
1169288257 20:4327594-4327616 GTCTATGAACAAAGGGTCCTGGG - Intergenic
1170347990 20:15408026-15408048 CTCTGTTAACAAACAGAACTCGG + Intronic
1170378754 20:15732325-15732347 CTCTGTGACCTGCAGGTACTGGG - Intronic
1170627468 20:18040667-18040689 CTCTGTGAAGAACTGGAACTGGG + Intronic
1173400366 20:42721147-42721169 CTTCATGAACAAAAGTTACTTGG + Intronic
1178572313 21:33750231-33750253 CTGTGGGAACAGAAGATACTAGG - Exonic
1179393080 21:41011364-41011386 GCCTGTGAACAAAAGGACCTGGG - Intergenic
1182828949 22:33289318-33289340 CCCTGTGAACATAAGTGACTTGG + Intronic
1183636955 22:39069899-39069921 CTCAATGAACAAAATGCACTGGG + Intronic
1183722018 22:39568152-39568174 CTCAGTGAATAAAAAGTGCTGGG - Intergenic
1184060879 22:42080320-42080342 CTCTGTAAATAAAGGGTACGTGG + Intronic
1184978273 22:48078651-48078673 CTCTGGGAAGAGAAGATACTGGG - Intergenic
951063160 3:18234131-18234153 CTCAGTGGACACAAGGTAGTAGG + Intronic
951436527 3:22671149-22671171 CTCTGAGGACAAAAAGTACCTGG + Intergenic
951750348 3:26028107-26028129 CTCTGAGGACAGAAGGGACTAGG - Intergenic
957667317 3:83249683-83249705 CTATTTGCAGAAAAGGTACTTGG + Intergenic
957692146 3:83585473-83585495 CTGTGTTTAGAAAAGGTACTTGG + Intergenic
958725675 3:97903033-97903055 TTCTAGAAACAAAAGGTACTTGG - Intronic
962244118 3:133777110-133777132 ATCTCTGAACAGAAGGTCCTTGG - Exonic
964146087 3:153465439-153465461 TTCTGTAAAGAAAATGTACTTGG - Intergenic
965473518 3:169125139-169125161 CTCTGTGAACAAAAGGTACTAGG + Intronic
965632236 3:170744871-170744893 CTCTGTCAACAAAATGGACAAGG + Intronic
967225863 3:187290587-187290609 CTCTCTGAACCACAGGTAATCGG + Intronic
967650282 3:191977167-191977189 CTCTGGAAACAAAAGGTAAAAGG + Intergenic
970598333 4:17619979-17620001 CTCTGTGTACACAATGTTCTGGG + Intronic
971542541 4:27837935-27837957 CTCTGATAACAAAAGGGGCTTGG + Intergenic
971798702 4:31260429-31260451 CTCTGTGGGCAGAAGGTAATGGG + Intergenic
974257861 4:59485210-59485232 AGCTGTAAACAGAAGGTACTGGG + Intergenic
974489446 4:62545813-62545835 CTCTGTGTATAAAATATACTTGG + Intergenic
975523318 4:75323466-75323488 CTTTGTGAACATAAGTTATTAGG - Intergenic
976498998 4:85764693-85764715 TTCTATGAACAAAAGCTATTTGG + Intronic
977834034 4:101627941-101627963 CTTTTTGAACAAATGGTGCTGGG - Intronic
978672412 4:111266070-111266092 CTCTTTGAACCCAAAGTACTTGG - Intergenic
980862779 4:138519519-138519541 CTCAGTGGACACAAGATACTAGG - Intergenic
982409140 4:155054163-155054185 CTCTGTTAAGAAAAGTTACCTGG - Intergenic
983359726 4:166712767-166712789 CTCTGGGAACAGAAGATAATAGG - Intergenic
983403924 4:167301612-167301634 CTCTGTGATGATAAGGAACTTGG + Intergenic
983768241 4:171514659-171514681 CTCTTTGGTCAATAGGTACTGGG + Intergenic
986007962 5:3683972-3683994 GTCTATGAACAACAGGTCCTGGG - Intergenic
986194821 5:5528098-5528120 CACTGTGAAAAAGAGGTTCTGGG + Intergenic
986326974 5:6683297-6683319 CTCTGTGTCCAAAAGGTAGAAGG - Intergenic
992225796 5:74618882-74618904 CTCTGTGAACTATGGTTACTGGG - Intergenic
995784371 5:115813332-115813354 ATTTGTGAATAAATGGTACTTGG - Intronic
995946903 5:117658907-117658929 CTCTGTTAAAAAAAGGTTTTTGG + Intergenic
996840476 5:127842531-127842553 ATTTTTGAACAAAAGGTACCTGG + Intergenic
1000654233 5:163856656-163856678 CTCTGTGACCTGCAGGTACTGGG - Intergenic
1001053689 5:168432394-168432416 CTCTTAGGACAAAATGTACTTGG - Intronic
1001400195 5:171441872-171441894 CTCAGTGCACAGTAGGTACTTGG + Intronic
1003668608 6:8134541-8134563 GTCTATGAACAAATGGTTCTGGG + Intergenic
1007274312 6:40662285-40662307 CTCTATCAAGGAAAGGTACTGGG - Intergenic
1010189345 6:73179009-73179031 TTCTGTGATCAAAAGGCTCTGGG + Intronic
1010610456 6:77948522-77948544 CCCTGTGAACAGAAAGTACGGGG + Intergenic
1010987693 6:82443941-82443963 ATCTGTGTACAAAAAATACTGGG - Intergenic
1012002931 6:93676925-93676947 CTCCTTGAACAATAGGTACATGG - Intergenic
1013431880 6:110063082-110063104 CTCTGAGAACAGAAGTAACTTGG + Intergenic
1014686648 6:124509545-124509567 ATCTGTGAACAAAAAGTGTTTGG + Intronic
1016414542 6:143819323-143819345 GACTGTGAAGAAAAGGTAATAGG + Intronic
1016524028 6:144979357-144979379 CCCTGTGAACAAAAAGTAGAAGG + Intergenic
1017265251 6:152437691-152437713 CTAAGTGAAGAAAATGTACTTGG + Intronic
1021507349 7:21400366-21400388 CTCTTTGAAGAAAATGTAGTGGG + Intergenic
1023206250 7:37753034-37753056 CTACGTAAACAAAAGGTATTAGG + Intronic
1023325175 7:39046933-39046955 GTCTGTTAACAAATGGTGCTGGG - Intronic
1023619818 7:42059050-42059072 CTCTTTAAACAAAAGTTAGTGGG - Intronic
1026128542 7:67600986-67601008 CTCTGTGCACAAAAGCAATTTGG + Intergenic
1027416398 7:77979188-77979210 CTATGTAAACAAAAGGTCTTTGG + Intergenic
1028189858 7:87833845-87833867 CTCTTGGAACAACATGTACTGGG - Exonic
1033260107 7:139836573-139836595 CTTTATCAACAAATGGTACTGGG + Intronic
1034174151 7:149087568-149087590 CTATGTGAACAAACAGAACTGGG + Intronic
1037504090 8:19513379-19513401 TTCTATGAACAGAATGTACTGGG - Intronic
1038294737 8:26280703-26280725 CTGTGTGTACATAAGGTACTGGG + Intergenic
1041576602 8:59404167-59404189 TTCTTTCAACAAATGGTACTGGG + Intergenic
1041818378 8:62000577-62000599 CTTTTTCAACAAATGGTACTAGG - Intergenic
1045893127 8:107181674-107181696 CTCTGTGAACTAAAGGCATGAGG - Intergenic
1046396206 8:113643254-113643276 CAATGTGAACAAAAGCTACTGGG - Intergenic
1048408676 8:134149499-134149521 CTCTGTGAAGGAAAGGTAGATGG + Intergenic
1050023298 9:1307484-1307506 CTGTGTGCAAAAAAGGTGCTCGG + Intergenic
1050220200 9:3379231-3379253 GTCTGTGAAGGAAAGGTACATGG + Intronic
1051726713 9:20095281-20095303 CTATGTAAACAAAAGTTATTTGG + Intergenic
1052252078 9:26410253-26410275 TTCAGTCAACAAAATGTACTGGG + Intergenic
1052981388 9:34452349-34452371 CCCTGAGACCAAAAGGTACATGG + Intronic
1054759719 9:68993397-68993419 CTATCTGAAAAAGAGGTACTTGG - Intronic
1055197899 9:73619238-73619260 CTTGTTGAACAAAAGCTACTGGG - Intergenic
1059391429 9:114001937-114001959 CTCTGTGACCACAAGGTCCCAGG - Intronic
1060886218 9:127154273-127154295 CCCTGTGGACACAAGGCACTTGG - Intronic
1187213792 X:17254919-17254941 CTCTGGGAACAGAAGGGACTAGG + Intergenic
1188551107 X:31365503-31365525 CTGTGTTACAAAAAGGTACTTGG + Intronic
1189833489 X:44998290-44998312 CTCTGTGAATAGAAGGAACATGG + Intronic
1191627009 X:63280518-63280540 CTCTGTGTACAAAAGATTGTTGG + Intergenic
1198967907 X:142246611-142246633 CTCTGTGAAAAAAATGTCATTGG - Intergenic