ID: 965477936

View in Genome Browser
Species Human (GRCh38)
Location 3:169180751-169180773
Sequence ACATAAAGAGAATACTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965477936_965477938 -7 Left 965477936 3:169180751-169180773 CCTTTCCAGTATTCTCTTTATGT 0: 1
1: 0
2: 2
3: 33
4: 391
Right 965477938 3:169180767-169180789 TTTATGTATGTGTGTGTGTGTGG 0: 1
1: 24
2: 453
3: 5786
4: 10776
965477936_965477939 22 Left 965477936 3:169180751-169180773 CCTTTCCAGTATTCTCTTTATGT 0: 1
1: 0
2: 2
3: 33
4: 391
Right 965477939 3:169180796-169180818 TATATATATATATATATATCAGG 0: 85
1: 1729
2: 1845
3: 4089
4: 9049

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965477936 Original CRISPR ACATAAAGAGAATACTGGAA AGG (reversed) Intronic
902129820 1:14250084-14250106 AGCAAAAGAGAATAATGGAAGGG - Intergenic
902428541 1:16343972-16343994 ACAAAAAAAGAAAACTGCAAAGG + Intronic
903783108 1:25835300-25835322 ACATACAGGGAATCCTGGAATGG - Exonic
904553293 1:31339627-31339649 ACAGAAAGAGATTAAGGGAAAGG - Intronic
905714783 1:40139564-40139586 AAAAAAAGAGGATACGGGAAAGG - Intergenic
906097700 1:43235451-43235473 CCATAATTAAAATACTGGAATGG + Intronic
906236099 1:44211874-44211896 ACATAGAAAAAATTCTGGAAAGG - Intergenic
906422274 1:45679579-45679601 ACAAAAAAGCAATACTGGAAGGG + Intronic
906533079 1:46534525-46534547 ACATCTAGAGAATCCTAGAAAGG - Intergenic
907226191 1:52949198-52949220 ATATCAAGAGAATTCTAGAAGGG + Intronic
907358460 1:53895509-53895531 CAAAAAAGAGAAAACTGGAACGG - Intronic
909246089 1:73286718-73286740 ACATAATAAGAGTACTTGAAGGG - Intergenic
909363406 1:74791473-74791495 ACAAAAGGAGAATACTTGAAAGG - Intergenic
911180133 1:94853141-94853163 ACAAACAGAGAAGACTGAAAGGG + Intronic
911932196 1:103919244-103919266 ACATAAAGATAATACTCAATGGG - Intergenic
912251612 1:108017831-108017853 ACATAAAGAACACACTGGAAAGG + Intergenic
912376799 1:109216056-109216078 ATGCAAAGAGAATATTGGAAAGG - Intronic
912719791 1:112010435-112010457 ATATAATGAGAATATGGGAAAGG + Intergenic
913271360 1:117096678-117096700 ATATAAAGAGAATTCTGATATGG + Intronic
916959657 1:169876296-169876318 AGATAAAAAGAAAAATGGAATGG + Intronic
918504042 1:185231876-185231898 ACATAACGATAAAACTGCAAAGG - Intronic
919102332 1:193109950-193109972 ATATAAAGAGATTAATTGAAAGG - Intergenic
919697143 1:200588978-200589000 ATAAAAAGAGAACACTGGAGTGG + Intronic
920533701 1:206723557-206723579 ACATGAAGACAAGACTGGGAAGG - Intronic
921246193 1:213243513-213243535 AAATAAAGACAATACAGTAAAGG - Intronic
922093889 1:222424356-222424378 ACAAAAAGTCAGTACTGGAAGGG + Intergenic
922612467 1:226940481-226940503 ACATGAAGAGAATGCAAGAAGGG - Intronic
922627743 1:227066715-227066737 AGCTAAAGAGAATACAGAAAGGG + Intronic
923158264 1:231296998-231297020 AAATCTAGAGAATAATGGAAGGG - Intergenic
924015085 1:239712328-239712350 ACCTGAAGAGAATTCTGTAAAGG - Intronic
924290819 1:242534619-242534641 ACATCAGGACTATACTGGAAAGG - Intergenic
924525138 1:244839563-244839585 ATATAAATAGAATACTTCAAAGG + Intronic
1062772349 10:112744-112766 AGATAAAGATAATAAAGGAATGG + Intergenic
1063249177 10:4255024-4255046 AGATTTAGAGAAAACTGGAATGG + Intergenic
1064382249 10:14856154-14856176 AGATAAAAAATATACTGGAAAGG - Intronic
1064843993 10:19630725-19630747 ACATAAAAAGAATAAGTGAAAGG + Intronic
1064909833 10:20387947-20387969 ACATAAACAGAAGAAAGGAATGG + Intergenic
1064916950 10:20468934-20468956 ACATAAGGAGAATACTCAGAAGG + Intergenic
1065073799 10:22055477-22055499 ACATAAAGAGAATTGTGCAGTGG + Intergenic
1065342256 10:24718436-24718458 TGAGAAAGAGAATACAGGAATGG + Intronic
1065900350 10:30201167-30201189 GCAAAAAGAGAAAACTGTAAAGG - Intergenic
1066137575 10:32465687-32465709 GCATAAAGGTAATACTTGAATGG - Intronic
1066691882 10:38037169-38037191 ACTTAAAGAAAATACAGGAGTGG - Intronic
1066750641 10:38652954-38652976 AGGGAAAGAGAAGACTGGAACGG + Intergenic
1066774097 10:38870974-38870996 ACAAAAAGAAAAGAATGGAATGG + Intergenic
1066966406 10:42270159-42270181 AGAGAAAGAGAAGACTGGAACGG - Intergenic
1067859587 10:49831735-49831757 ACATAAAGCGAAGCCTAGAAGGG - Intronic
1069463720 10:68619226-68619248 AAAAAAAGAGAATAACGGAAGGG - Intronic
1070029364 10:72662176-72662198 AAATAAATAGACTACTGGGATGG - Intergenic
1071043630 10:81345253-81345275 ACATAAAGAGAATATAAAAAAGG - Intergenic
1071778721 10:88818634-88818656 CCATAGAAACAATACTGGAAGGG + Intronic
1072997511 10:100258607-100258629 AGATAAAGAGAATATTAGCACGG + Intronic
1073899271 10:108201070-108201092 ACATGAAGATTATACTGCAAGGG + Intergenic
1074035016 10:109729932-109729954 ACAAAAAGAAAAGAGTGGAAAGG - Intergenic
1076268031 10:129125422-129125444 GCATAAAGAGAAAAATGGTAAGG + Intergenic
1076353311 10:129833290-129833312 ACATAAAAGGAATCCTTGAAGGG + Intergenic
1079054135 11:17190677-17190699 ACAGAAAAGAAATACTGGAAAGG + Intronic
1079404930 11:20136475-20136497 ACATAAGGAGGATTCTGGGAAGG + Intergenic
1080072034 11:28100758-28100780 CCAAAAATAGAATACTGAAAAGG + Intronic
1080299259 11:30766506-30766528 GCATGGAGAGAAGACTGGAAAGG - Intergenic
1080693199 11:34577085-34577107 TCAGAAAGAGAATAGAGGAAAGG + Intergenic
1081034135 11:38120461-38120483 AAATAAAGAGAAAAAGGGAAGGG + Intergenic
1081306721 11:41520944-41520966 CTCTAGAGAGAATACTGGAATGG + Intergenic
1081330688 11:41796206-41796228 AAATAATGAGATTTCTGGAAGGG - Intergenic
1082642357 11:55678966-55678988 ACAGAGAGAAAACACTGGAAAGG + Intergenic
1084056804 11:66639166-66639188 AGATAAAGGAAATACTGGAGTGG - Exonic
1085210561 11:74773683-74773705 TCATAAATAGTATTCTGGAAAGG + Intronic
1086235124 11:84621092-84621114 ACATAAATAGAATTAGGGAATGG + Intronic
1086920276 11:92578874-92578896 TCATAAAAAAAATGCTGGAAAGG + Intronic
1087846229 11:102976618-102976640 ACATAAAGAGAAAAAGGGAAAGG - Intergenic
1088788395 11:113202894-113202916 AGGTAAATAGAATACTGGTATGG + Intronic
1089121790 11:116141350-116141372 AGAGAAAGAGAATTCTGGGAGGG + Intergenic
1090770253 11:129913268-129913290 ACAGAAATAGAAGAATGGAAGGG + Intronic
1092700869 12:11229355-11229377 ACATAAATAGATTATTGGGAGGG - Intergenic
1092803175 12:12191822-12191844 ACATAAAGAAAAAAATGAAAAGG + Intronic
1092945212 12:13447988-13448010 AGAGAAAGAAAATACTGGAGCGG - Intergenic
1093050311 12:14496963-14496985 ACATGAAGAAAAATCTGGAAAGG - Intronic
1093164159 12:15786693-15786715 ACATCTAGAAAATACTGAAAAGG + Intronic
1093563792 12:20577610-20577632 ACATAAAGAGATTATTTGACTGG - Intronic
1093689715 12:22096763-22096785 TCATATAAAGAATACTGAAATGG - Intronic
1093983458 12:25500746-25500768 AAGTTAAGAGAATTCTGGAAAGG - Intronic
1094403822 12:30093242-30093264 ACATAAAGGGAATAATGGTTGGG - Intergenic
1094563020 12:31573791-31573813 AGATAAAGAGAATTCTGGCCAGG + Intronic
1097502397 12:60421464-60421486 ACATACTGCCAATACTGGAATGG + Intergenic
1097594313 12:61609510-61609532 ACAAAAAGAGAATACTAAAAAGG - Intergenic
1097626268 12:62004393-62004415 AAATAAAGAGAGAGCTGGAAAGG + Intronic
1097703549 12:62845122-62845144 ACATCAAAAGACTACTGCAAAGG + Intronic
1098314531 12:69179107-69179129 ACAAAAAGAGAATTTTAGAATGG + Intergenic
1098964150 12:76768132-76768154 GCATATAGTGAATACTGAAAGGG + Intronic
1100648896 12:96562724-96562746 ATATAAACAGAATACAGGCAGGG - Intronic
1100663952 12:96730015-96730037 AGAAAAAGAGAAGACTGGACCGG - Intronic
1103233225 12:119349952-119349974 ACTTAAAGAGACTACTAGAGTGG - Intronic
1103526492 12:121572595-121572617 AAATAAACAGAATAATGGCATGG - Intronic
1103652184 12:122441461-122441483 AAAAAAAGAGAATTCTGGACTGG - Intergenic
1105527433 13:21188776-21188798 AAAAAAAGAGAATATTGTAAAGG + Intergenic
1107847273 13:44529111-44529133 AGAAAAAGATAATACTAGAAAGG + Intronic
1109452758 13:62539778-62539800 ACAGAGAGAAAATACTGGAGAGG - Intergenic
1110649854 13:77931209-77931231 AAATAAAGACATTAATGGAAAGG + Intergenic
1111089158 13:83419726-83419748 ATATAAAGAGAACACTAGGAAGG - Intergenic
1112691425 13:101899456-101899478 AAAAAAATATAATACTGGAAAGG + Intronic
1112946441 13:104933230-104933252 AAATAAAGAGAATTGTGAAAAGG - Intergenic
1114349850 14:21837664-21837686 ACCCAAAGAGAATAATAGAAAGG + Intergenic
1114595665 14:23909635-23909657 CCATAAAGAGATTATTGTAATGG - Intergenic
1114602338 14:23966862-23966884 ACATAAAGAGATTTCTGGGTGGG + Intronic
1114606703 14:24003977-24003999 ACATAAAGAGATTTCTGGGTGGG + Intronic
1115178787 14:30598032-30598054 TCTTAAAGAGAATCCTGAAAAGG + Intronic
1116344884 14:43780220-43780242 TCAGAAAGAGAATACAGAAAGGG + Intergenic
1117383194 14:55185973-55185995 AAATAAAGACATTTCTGGAAGGG + Intronic
1117389953 14:55253312-55253334 ACATAAAGTGAAAAGTGGAATGG + Intergenic
1118480204 14:66157020-66157042 AAATAAAAAGAAGACTCGAAAGG - Intergenic
1119958342 14:78825243-78825265 CTATAAAAAGAATACAGGAATGG - Intronic
1120165157 14:81190169-81190191 ACAGAAACAAAATACTTGAAGGG + Intronic
1120211989 14:81642280-81642302 ACACAGAGAGTATACTGAAATGG - Intergenic
1121503646 14:94459770-94459792 GCATCAACAAAATACTGGAATGG - Intergenic
1121930922 14:97971505-97971527 AGAGAAAGACAATCCTGGAAAGG + Intronic
1122711207 14:103659643-103659665 ACATAATCAGAATACTAGAGAGG + Intronic
1123603874 15:22003970-22003992 CCATAAAGAGAGCACTGGGATGG - Intergenic
1123631358 15:22262277-22262299 ACAAAAAGAAAAAACTGCAAAGG - Intergenic
1123831803 15:24146908-24146930 AGACAAAGAGAATACTGAATGGG - Intergenic
1123836781 15:24202924-24202946 AGACAAAGAGAATACTGAATGGG - Intergenic
1125467913 15:39973076-39973098 ACATAAACCAAAAACTGGAAGGG + Intronic
1125994217 15:44142007-44142029 ACATAAAGAGATTATGGAAAAGG - Intronic
1126723068 15:51602538-51602560 ACAGAAAGAGGAGTCTGGAAAGG + Intronic
1127340265 15:58034932-58034954 AGATAAAGAGATTACGAGAATGG - Intronic
1127589311 15:60407703-60407725 ATATAACCTGAATACTGGAAGGG - Intergenic
1127663004 15:61118167-61118189 ATATACAGAGAGTATTGGAAAGG + Intronic
1127792626 15:62411840-62411862 AACTAAAGAGAAAAATGGAAAGG + Intronic
1128830099 15:70760821-70760843 ACAGAAAAAGAAAAATGGAAAGG + Intronic
1129142665 15:73614407-73614429 ATATAACCAGAAGACTGGAATGG + Intronic
1130019556 15:80216592-80216614 AAATAAATAAAATAATGGAAGGG - Intergenic
1130621141 15:85463766-85463788 ACATAAAGCGACTACTGGGGAGG + Intronic
1130744508 15:86636427-86636449 ACATACAGAGAAGACAGGAGAGG + Intronic
1131292545 15:91119107-91119129 ACATAAATAAAATGCTGGCAGGG + Intronic
1131557327 15:93411213-93411235 AGATAAACAGCATACTTGAATGG + Intergenic
1131975085 15:97936217-97936239 AATTAAAAAGAATCCTGGAAAGG + Intergenic
1133901942 16:9984046-9984068 ACAAAAAGTAAATACTGGCAAGG - Intronic
1134329858 16:13240925-13240947 AAATGAAGAGAATACTGGGAGGG + Intergenic
1137232573 16:46580710-46580732 ATATAATCAGAATACTGTAACGG + Exonic
1137319360 16:47363816-47363838 AAAAAAAGAGAAGACTAGAAAGG - Intronic
1139151561 16:64387869-64387891 AAATAAAGAGGACAATGGAAAGG - Intergenic
1140286575 16:73608084-73608106 AAAAAAAGAGAATAGGGGAAGGG + Intergenic
1140398467 16:74649503-74649525 ACCAAAAGAAAATAATGGAATGG - Intronic
1140709894 16:77667669-77667691 ACAGAAAAATAACACTGGAATGG + Intergenic
1142913636 17:3115843-3115865 GCAGCAAGAGAATACTGGAGTGG + Intergenic
1144384538 17:14737083-14737105 ACTTGGAGAGAAAACTGGAAAGG + Intergenic
1144571361 17:16401611-16401633 AGAGAAAGAGAAAAATGGAAAGG + Intergenic
1146963909 17:37008932-37008954 ACTTAAAGAGACTACAGGAAAGG + Intronic
1148510986 17:48169659-48169681 ACAGAAAGTGAATACTTAAAAGG - Intronic
1155610943 18:27666923-27666945 AGAAAAAGAGAATAAGGGAAAGG + Intergenic
1155637245 18:27970534-27970556 ACATAAAGTAAATACTGCAAAGG + Intronic
1156284810 18:35681778-35681800 ACAACAAGAGAATCCTAGAAGGG - Intronic
1156356336 18:36344568-36344590 GAATAAATAGAATACTAGAAAGG + Intronic
1156870067 18:41935239-41935261 AAAAAAAGAAAATACTGAAAGGG - Intergenic
1157061093 18:44291476-44291498 ACAAAGAGAGAATCCTGGACAGG - Intergenic
1157411086 18:47464194-47464216 TCAGAAAGAGATGACTGGAATGG + Intergenic
1157634487 18:49137311-49137333 ACATGGAAAGAATACTGGCAGGG + Intronic
1158249455 18:55470469-55470491 ATATAAAGAGAATACTCTAATGG - Intronic
1159057906 18:63484720-63484742 AGATTAAGAGAGTCCTGGAATGG - Intronic
1159463815 18:68753855-68753877 ATAAAAAGATAATACTGGATGGG - Intronic
1160376887 18:78420431-78420453 ACATCATGAAAATGCTGGAAAGG - Intergenic
1162902378 19:13802961-13802983 ATGTAATGAGAATAGTGGAAAGG + Intronic
1164122498 19:22279845-22279867 AAAAAAAGAGAATTCTAGAATGG + Intergenic
924978234 2:197123-197145 ACTTAAATAGCATACTGTAAGGG + Intergenic
924978783 2:201301-201323 ACTTAAATAGCATACTGTAAGGG + Intergenic
925351276 2:3202285-3202307 ACCTAAAGGGAATACTACAAAGG - Intronic
925607243 2:5672125-5672147 ACAAAAAGGGAAGACTGGATGGG + Intergenic
927561626 2:24077430-24077452 AAATAAAGAGTGAACTGGAAGGG - Exonic
927825654 2:26308007-26308029 AAAAAAAGAGAACACTGCAATGG + Intergenic
928598686 2:32882362-32882384 TCTTAAAGAGAAAAATGGAAAGG + Intergenic
930042019 2:47132807-47132829 ACAAAAAAAGAAAACTGAAAAGG + Intronic
930166207 2:48206041-48206063 AGAGAAAGTTAATACTGGAAAGG + Intergenic
930262064 2:49158641-49158663 AAATAAAGAGAATTTTGGAAAGG - Intergenic
930380264 2:50619033-50619055 ACATAAAGAGAAGACAGGGAAGG + Intronic
930705455 2:54500942-54500964 CTATAAAGAGAGGACTGGAAAGG - Intronic
931768376 2:65476831-65476853 ACAGAAAGGGAATACCGGAAGGG - Intergenic
932516159 2:72351971-72351993 AAATAAAGAGCATACTGAAGAGG - Intronic
934136191 2:88998566-88998588 ACATAGAGACAGAACTGGAATGG - Intergenic
934139756 2:89035113-89035135 ACATAAAGACAGAACTGCAATGG - Intergenic
934229488 2:90165438-90165460 ACATAAAGACAGAACTGCAATGG + Intergenic
934313644 2:91895109-91895131 AGGGAAAGAGAAGACTGGAACGG + Intergenic
935186712 2:100741099-100741121 ACAAAAACAGAATACAGCAACGG + Intergenic
935317166 2:101846758-101846780 AGATTAAGAAAATATTGGAATGG + Intronic
935791008 2:106590182-106590204 ACATAAAGACAACAGAGGAATGG - Intergenic
935887068 2:107633760-107633782 AAAGAAAGAGTATACTGCAAGGG + Intergenic
936456642 2:112680166-112680188 ACTTAAAGCAAATACTAGAACGG - Intergenic
937565679 2:123284309-123284331 ATAAAAATAAAATACTGGAATGG - Intergenic
940128669 2:150356695-150356717 ATAGAAAGAGAACACTGTAATGG + Intergenic
942003099 2:171669993-171670015 AGATAAAGATAATATTGAAAAGG - Intergenic
942407388 2:175669954-175669976 AAATACAGAGAATACTGCAAAGG + Intergenic
942686124 2:178533847-178533869 ACACAATGAGACTCCTGGAAAGG - Exonic
942835912 2:180298013-180298035 ACATAAAGATATTACAGGAAAGG - Intergenic
942856135 2:180551244-180551266 ATATAGAGAAAATACTGGCAGGG + Intergenic
942940424 2:181609087-181609109 AAATAAAGAGAATACTGGCATGG - Intronic
943293498 2:186106784-186106806 ACAAAAGGAGGATACTGAAAAGG + Intergenic
943821564 2:192329690-192329712 ACACAAAGAAAAAACTTGAATGG - Intergenic
944426228 2:199586214-199586236 ACATAATGTGAATATTTGAAGGG + Intergenic
944518352 2:200536406-200536428 ACATAAAGACATTAGTAGAAAGG + Intronic
944742124 2:202622728-202622750 ACATAAAGAAAATATTGGCCAGG - Intergenic
945137453 2:206643266-206643288 ACATAAAGAAAAAATAGGAAGGG - Intergenic
945750719 2:213779082-213779104 AGTTAAAGGGAAAACTGGAAAGG - Intronic
945838168 2:214857209-214857231 GCATAAACAAAATACAGGAAGGG - Intergenic
946944821 2:224810143-224810165 ACAATAAGAGAATACTTGATAGG + Intronic
1169477076 20:5941228-5941250 ACAAAGAGGTAATACTGGAATGG - Exonic
1169844035 20:9970728-9970750 ACATAATGTGGATACAGGAAGGG - Intergenic
1171432695 20:25094063-25094085 AGATAAAGACATTACAGGAAAGG + Intergenic
1171853292 20:30323565-30323587 AAATATAGAGAACACAGGAAAGG + Intergenic
1172028162 20:31963515-31963537 AAATAAAGAGATTACTGAATGGG - Intergenic
1172287958 20:33754442-33754464 ACATAAAGAGACTACCTGACAGG - Intronic
1172342624 20:34170338-34170360 AGATACAGAGAAGACTGGGAAGG - Intergenic
1175135488 20:56820442-56820464 AAATATAGAGAATAGGGGAATGG + Intergenic
1175478815 20:59296981-59297003 ACATAAAGAGACAACTTGAGGGG + Intergenic
1177483202 21:21720784-21720806 ACATAAAGAGAAATTGGGAAGGG - Intergenic
1180540388 22:16441016-16441038 AGGGAAAGAGAAGACTGGAATGG + Intergenic
1181779089 22:25179774-25179796 ACCTAAAGAGAATACAGGGGTGG - Intronic
1182131070 22:27851247-27851269 ACAAAAAGAGCAGACTGGAAAGG + Intergenic
1182181140 22:28349534-28349556 ACAGAAAAAGAGCACTGGAAAGG + Intronic
949612902 3:5721115-5721137 ACATTAAGAGAATAAGGAAAGGG - Intergenic
949653729 3:6192284-6192306 GCACAATGAGAATACTAGAAGGG - Intergenic
949904652 3:8848843-8848865 ACATATAGAGCATGCAGGAAAGG + Intronic
949914766 3:8951045-8951067 ACATAATGGGAATACCAGAAAGG + Intronic
950592317 3:13947385-13947407 ACATCAAGGGAATACTGCATGGG - Intronic
951038202 3:17957519-17957541 ATATAGAGAGAATAGTGTAATGG + Intronic
951598284 3:24342283-24342305 ACAGAAAGAGAATAATGCAGGGG + Intronic
951668091 3:25149342-25149364 ACATAAATATATTACTGCAAAGG - Intergenic
951703665 3:25522647-25522669 AAAGACAGAGAACACTGGAAAGG + Intronic
952042315 3:29275905-29275927 ACATAAAGATTATACATGAATGG + Intergenic
952797654 3:37256311-37256333 AGACAAAGAGAACAGTGGAACGG - Intronic
953532364 3:43750009-43750031 AGAAAGAGAGAACACTGGAAAGG - Intergenic
954911064 3:54110242-54110264 AAATAAAGATAAAATTGGAAAGG - Intergenic
955953296 3:64263554-64263576 ATATACAGAGAATGCAGGAAGGG + Intronic
956226480 3:66964854-66964876 ATATAAGGAGATTACTGGAGAGG - Intergenic
956412600 3:68994342-68994364 AAATAAAGAGAGTCCTGCAAGGG + Intronic
957155854 3:76542984-76543006 ACAAAAAGAGAAGACGGCAAAGG - Intronic
957927702 3:86835792-86835814 AAAGAAAGAGAAAAATGGAAAGG + Intergenic
958494009 3:94818954-94818976 ACATATAGAAAATATTTGAATGG - Intergenic
958606269 3:96362324-96362346 ACATAAAGTGAAATATGGAAAGG + Intergenic
959223753 3:103555158-103555180 AAATTAAGAGAATAGAGGAAAGG + Intergenic
960106128 3:113799114-113799136 AGATAAAGACAATACAAGAAAGG + Intronic
960152295 3:114262514-114262536 ACAAAAAGATATTACTGGAAAGG + Intergenic
960295371 3:115936474-115936496 ATAAAAAGAGAATCCTGGATTGG + Intronic
960361588 3:116718709-116718731 AAATAAAAAGAATATTTGAATGG + Intronic
960441953 3:117699696-117699718 ACATTAATTGAATATTGGAAAGG + Intergenic
961886544 3:130100245-130100267 AAATAAAAAAAATACTGGCATGG - Intronic
962831217 3:139143012-139143034 AAATAAAGAGAATGCATGAAAGG + Intronic
963373015 3:144426088-144426110 TGATATAGAGAAAACTGGAATGG - Intergenic
963751010 3:149180055-149180077 ACATGCAGAGATTACGGGAAAGG - Intronic
965051029 3:163647904-163647926 ACATAGAAAGAATGCAGGAAAGG + Intergenic
965203005 3:165684400-165684422 AAATAAAATGAATACTGGATAGG - Intergenic
965403309 3:168239748-168239770 ACATAAAGAAAATTCTAAAAGGG - Intergenic
965477936 3:169180751-169180773 ACATAAAGAGAATACTGGAAAGG - Intronic
965556830 3:170027283-170027305 ATATCAAGAGGTTACTGGAAAGG + Intergenic
966314404 3:178629540-178629562 ACATAAACAGAATCCTGGTCTGG + Intronic
966395352 3:179496713-179496735 ACATAAAGTCAAAACTGTAACGG + Intergenic
966500064 3:180628907-180628929 ACATAAGAAGAATAAGGGAAGGG + Intronic
966855120 3:184188636-184188658 AGAGGAAGAGAATACAGGAAGGG - Intronic
967178100 3:186878871-186878893 ATATAAAGAGAATAATTGTATGG - Intergenic
967437837 3:189471254-189471276 ACCTAAAGTGAATAGTGCAATGG + Intergenic
968763462 4:2455311-2455333 ACATAAAAAGAATATTTGCATGG - Intronic
969195235 4:5557103-5557125 AGATAAAGAAAATACAAGAAAGG + Intronic
970770572 4:19607303-19607325 ACAAGAAAACAATACTGGAAAGG - Intergenic
971815734 4:31485883-31485905 ACAAAAAGACAATACTGAAGTGG - Intergenic
972105548 4:35481211-35481233 ACAAAAAAAGACTACTGGGAAGG - Intergenic
973150634 4:46883358-46883380 ACAGAAAGGGAATTCTGAAAAGG - Intronic
974413819 4:61578164-61578186 ACACACAGAGAAAACAGGAAAGG - Intronic
975375362 4:73637573-73637595 ACAAAAACATAATTCTGGAAAGG + Intergenic
975418538 4:74135183-74135205 GCATAAAGATAAAACTGTAATGG + Intronic
975478119 4:74845849-74845871 ACACAAAAAGCATACAGGAATGG - Intergenic
976242938 4:82977360-82977382 CCCCAAAGAAAATACTGGAAAGG - Intronic
976382891 4:84420335-84420357 AGATAAAAAGAATACTGGGAAGG + Intergenic
976708096 4:88039975-88039997 AGATAAATAAAATATTGGAAAGG - Intronic
977046522 4:92074504-92074526 ACATACACAGAAAACAGGAAAGG + Intergenic
977945853 4:102913164-102913186 AGGGAAAGAGAAGACTGGAACGG + Intronic
978053016 4:104227073-104227095 TGATGAAGATAATACTGGAAAGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979778530 4:124620573-124620595 TAATAAAGAGAATAGTGGAATGG + Intergenic
979939709 4:126745581-126745603 ATATAAAGAGAAGACTGTAATGG + Intergenic
979985048 4:127303633-127303655 ACATAATGAGAAGATTGGGAAGG - Intergenic
980704761 4:136478845-136478867 ACATAAAAAGAACACAAGAATGG - Intergenic
982034961 4:151336931-151336953 ACATAAAGAGAAATCTGCAAAGG + Intergenic
982205300 4:152993357-152993379 AGAAAAAGAGAATTCTGGCAGGG - Intergenic
983178565 4:164620767-164620789 ACATACAGAGAAGATTGGCATGG + Intergenic
983706713 4:170669623-170669645 ACATAATTGGAATACTGGAAGGG - Intergenic
983712629 4:170738275-170738297 ACATAAAAATAATATTGTAAAGG - Intergenic
984444948 4:179824938-179824960 ACATAAAGGGGACACTGGGATGG - Intergenic
986238106 5:5931293-5931315 ATATAAAGTGAGTTCTGGAATGG - Intergenic
986428020 5:7654133-7654155 AGATAAAGAGAAGTCAGGAAAGG + Intronic
986536339 5:8791709-8791731 AGATAATCAGAATCCTGGAAAGG + Intergenic
986776813 5:11022990-11023012 AAATAAAGAGAAGAGTTGAAAGG + Intronic
987611148 5:20204532-20204554 GCAAAAAGAAAATATTGGAAGGG + Intronic
988465628 5:31488803-31488825 AAATGAAGGGAAGACTGGAAAGG + Intronic
989267159 5:39488270-39488292 AGATAAAGAGACTTCTGGAATGG + Intergenic
989317495 5:40099459-40099481 AAATAAAAAGAAAGCTGGAAAGG + Intergenic
991227213 5:64286887-64286909 ATATAAAGGGCAAACTGGAAGGG + Intronic
991472783 5:66986532-66986554 ACAGAGAGAAAGTACTGGAAAGG - Intronic
991587235 5:68214155-68214177 ACCTAAAGGAAATACTGGGAAGG + Intergenic
993652860 5:90543079-90543101 ACATCAGGAAAGTACTGGAAAGG + Intronic
994264324 5:97696952-97696974 AGAAAAAGAGAATGCTGTAAGGG + Intergenic
995136062 5:108681346-108681368 ACTGAAAGAGAAAACTGGAGAGG + Intergenic
996419555 5:123247258-123247280 ACATAAAGAAATTATTCGAAAGG + Intergenic
997245259 5:132342762-132342784 ACATACAGAGAGGTCTGGAAGGG + Intronic
997525476 5:134550342-134550364 CCACAAGGAGAACACTGGAATGG - Intronic
999915140 5:156250461-156250483 ACAGAAAGAAAATCCTGGACTGG + Intronic
1001031590 5:168267080-168267102 AAAAAAAAAGAATTCTGGAAAGG + Intergenic
1001486452 5:172123079-172123101 CCAAAAAGAGAAACCTGGAATGG + Intronic
1002258025 5:177973574-177973596 ACATCAAGAGACAACTTGAAGGG - Intergenic
1002590446 5:180287789-180287811 ATCTAAAGCGAATACTGGGAGGG - Intronic
1002704308 5:181149753-181149775 AAATAGACAGAAAACTGGAAAGG - Intergenic
1003511866 6:6788436-6788458 ATATTGAGAGGATACTGGAAGGG + Intergenic
1003965269 6:11246721-11246743 AAAGAAATAGAATACTGCAAGGG - Intronic
1005077588 6:21923884-21923906 ATAAAAACAGAATCCTGGAAGGG - Intergenic
1005173249 6:23012606-23012628 AAAAAAAGAGAATAGTGTAAGGG + Intergenic
1005304132 6:24497232-24497254 ACAGAAACGGAACACTGGAAGGG - Intronic
1005697410 6:28364314-28364336 ACTTAACTAGAATACTGGCACGG - Intronic
1008267136 6:49441901-49441923 ACATAAAGCGAATGATCGAATGG - Exonic
1008428058 6:51381932-51381954 ACATAAAGAGACAACTGGCATGG + Intergenic
1009419814 6:63453322-63453344 ACATAGAGAGAAAATTAGAAAGG - Intergenic
1009816208 6:68738944-68738966 ACATGAAGAGGATACAGGAAAGG + Intronic
1010093962 6:72017729-72017751 AAATAAAGAGAATAGGGGCAGGG + Intronic
1010757795 6:79686939-79686961 ACAGAAAGGGAAAAATGGAAAGG - Intronic
1010991032 6:82480125-82480147 ATACACAGAGAATTCTGGAATGG + Intergenic
1012000994 6:93654978-93655000 AAAGAAAGAGAAAGCTGGAAAGG + Intergenic
1012671255 6:102050679-102050701 ATAAAAAGAGAGTACAGGAAAGG + Intronic
1013265436 6:108492723-108492745 ACAAAAAAAAAATACTGGCAAGG - Intronic
1014322860 6:119952716-119952738 ACATAGAAAGAAGACTGTAATGG - Intergenic
1014669250 6:124279907-124279929 TCATAAAGATAGTAATGGAAGGG + Intronic
1015159552 6:130137207-130137229 ACAAATAGTGAATAGTGGAAAGG + Intronic
1016111340 6:140229640-140229662 TTAGAAAGAGAATAGTGGAAAGG + Intergenic
1016340671 6:143059150-143059172 ACAGAAACAGAACACTGGAGAGG + Intergenic
1016829478 6:148419303-148419325 ACATAAAGAGAATCCAAAAAGGG - Intronic
1018581310 6:165310599-165310621 CCAGAAAGAGAGTACTGGAAGGG + Intergenic
1020937087 7:14480100-14480122 ACATAAACAGAATAGAGAAAGGG + Intronic
1021900446 7:25279832-25279854 TCAGTAAGAGAATGCTGGAAAGG + Intergenic
1022240424 7:28506316-28506338 TTATAAAGAGAATGCAGGAATGG + Intronic
1022332548 7:29394213-29394235 AAATTAAGAGAAAAATGGAAAGG - Intronic
1023448359 7:40255236-40255258 AAAAAAAAAGAATCCTGGAAAGG + Intronic
1023564863 7:41514164-41514186 ACAGAAACAGAATACTTTAAAGG - Intergenic
1024514547 7:50234516-50234538 ACATAAAAAAAAGAATGGAAGGG - Intergenic
1024695024 7:51847066-51847088 ACATGAAGTGTATACTGGGAAGG - Intergenic
1027473946 7:78606822-78606844 ACATAAAGAAAATTGTGGGAGGG - Intronic
1027618494 7:80453382-80453404 TAATAAACAGAATAATGGAATGG + Intronic
1027750225 7:82134238-82134260 ACATAAAGAATATACTTAAATGG - Intronic
1028118613 7:87030741-87030763 ACATACAGAGAGTACTTGATTGG - Intronic
1029984622 7:104911717-104911739 AAATAGAGAGAATAAGGGAAAGG + Intergenic
1030478158 7:110064625-110064647 ACCGTAAGAGAAGACTGGAAAGG - Intergenic
1031007021 7:116484968-116484990 ACATAAAAAGAATAATGTATTGG + Intronic
1031222624 7:118989927-118989949 ACATGAAGAGATTTCTAGAATGG + Intergenic
1033766530 7:144498263-144498285 ACATAAACAGTATTCTGGAAAGG + Intronic
1034600453 7:152248588-152248610 ACATACAGTGAATACTGAATTGG - Exonic
1034958673 7:155350919-155350941 ACATACAAAGAATAATGAAATGG + Intergenic
1035444835 7:158933109-158933131 ACAGAAAGAGAAAATTGGAAAGG + Intronic
1037110366 8:15158235-15158257 ACAGAAAGAGAAACCTGGTATGG - Intronic
1037659691 8:20916126-20916148 ACATCAAGAAAATACAGAAATGG + Intergenic
1038975790 8:32694357-32694379 ACATACAGAACATTCTGGAAAGG - Intronic
1039203817 8:35126782-35126804 AGATAAAGAGAAAAATGGATAGG - Intergenic
1039250815 8:35662091-35662113 TCATAGAGAAAATGCTGGAATGG - Intronic
1039404523 8:37301187-37301209 ACAGAAACAGATCACTGGAATGG + Intergenic
1039905519 8:41783470-41783492 AGGAAAAGAGAATACTGAAAAGG - Intronic
1040542137 8:48369245-48369267 AAAGAAAGAGAACAATGGAAAGG - Intergenic
1040628503 8:49180125-49180147 ACTAAAAGAGAATAATTGAATGG + Intergenic
1040815524 8:51504339-51504361 GGATAAAGGGGATACTGGAAGGG - Intronic
1041864313 8:62551993-62552015 GCATAAAGAACATAATGGAAAGG - Intronic
1041887213 8:62824334-62824356 AAACAATGAGAATACTGCAAAGG - Intronic
1041961313 8:63619650-63619672 ACAAAATGAGAATACTGGGCGGG - Intergenic
1041983027 8:63885391-63885413 AAATAAAGAGATCAGTGGAATGG - Intergenic
1043186870 8:77163499-77163521 ACATAAAGAAAATGCTGGAAAGG - Intergenic
1044079264 8:87863814-87863836 ACATAGAGTCAACACTGGAATGG - Intergenic
1044507951 8:93042191-93042213 GGATGAAGAGAATACTGGAGTGG - Intergenic
1044827321 8:96210807-96210829 ACCTAAATTGAATACTAGAAGGG - Intergenic
1044837588 8:96311519-96311541 ACATACACAGAAAAATGGAAAGG - Intronic
1045688606 8:104737248-104737270 ACAGAAAGATACTACAGGAAAGG - Intronic
1046497064 8:115027641-115027663 ACATAAATAAAATAGTGAAAAGG - Intergenic
1046593867 8:116237538-116237560 ACACAAAGAGATTAATGGCAAGG - Intergenic
1046796036 8:118373182-118373204 AGATAAAAAGAATACTGGCATGG + Intronic
1047433624 8:124815888-124815910 ATATAAAGATAATATTGGATAGG - Intergenic
1047818701 8:128494394-128494416 ACATAACTAGAAAACAGGAATGG + Intergenic
1050632709 9:7577622-7577644 TGAGAAAGAGAATACTGGAGAGG - Intergenic
1050864971 9:10487381-10487403 AACTAAAGAGAAGACAGGAAGGG - Intronic
1051400608 9:16678063-16678085 AAAAAGAGAGAATAATGGAAAGG + Intronic
1051475159 9:17498625-17498647 GCATAAAGAGAAAAATGGACAGG - Intronic
1051664957 9:19460242-19460264 ACATAAAGATACCACTGAAAAGG - Intergenic
1051875703 9:21791042-21791064 ACATAAAGTGAAGTCTAGAAGGG - Intergenic
1052671106 9:31558228-31558250 ACATAAAGGGGATACTAAAATGG + Intergenic
1053242807 9:36510172-36510194 AAATAAATAGATTAATGGAAAGG + Intergenic
1053525406 9:38825041-38825063 AGAGAGAGAGAATTCTGGAATGG - Intergenic
1054197635 9:62049468-62049490 AGAGAGAGAGAATTCTGGAATGG - Intergenic
1054640774 9:67539233-67539255 AGAGAGAGAGAATTCTGGAATGG + Intergenic
1054859544 9:69934727-69934749 GCATAAAGGGAATATTGGAGAGG + Intergenic
1054965295 9:71019277-71019299 AAATTAAAAGAATATTGGAAAGG + Intronic
1055830597 9:80373890-80373912 ACATAAAAGGAATAATAGAAAGG - Intergenic
1056279249 9:85023971-85023993 AAAAAAAGACAAAACTGGAATGG - Exonic
1056493821 9:87136039-87136061 GCAAAAAGAGAAAAATGGAACGG - Intergenic
1056782122 9:89558464-89558486 ACACAAAGAGAAATATGGAATGG - Intergenic
1060370521 9:123065777-123065799 TTATAAAGTGAATACTGAAAAGG - Intronic
1062418745 9:136468281-136468303 ACATAAAGAGATTAATAAAAGGG + Intronic
1203678703 Un_KI270756v1:45334-45356 ACAAAAAGAAAAGAATGGAATGG - Intergenic
1186691104 X:11976706-11976728 TCATAAAGAGACAACTTGAATGG - Intergenic
1186793284 X:13019786-13019808 ACATAGAGAGAGTAGTAGAAAGG - Intergenic
1187301203 X:18051753-18051775 ACATTCAGTAAATACTGGAAAGG + Intergenic
1187701640 X:21969141-21969163 TTATAGAGAGAATAGTGGAAGGG - Intronic
1188191739 X:27179829-27179851 ACATAAATAGAATAATAAAATGG + Intergenic
1188632439 X:32382070-32382092 AAATAATGAGAATAAAGGAAGGG - Intronic
1188948302 X:36335943-36335965 TCATAATGAGAAAACTGTAAAGG + Intronic
1189596102 X:42567099-42567121 ACAGAAAAAGAACAATGGAAGGG - Intergenic
1190288676 X:48977286-48977308 AAAGAGAGAGAATTCTGGAAGGG + Intronic
1192138448 X:68628738-68628760 AAAAAAAGAGAAAACTTGAATGG - Intergenic
1192998644 X:76539674-76539696 ACTGAAAGAGAAGACTGGAGAGG - Intergenic
1193801109 X:85937448-85937470 ACATACAGAGAAAACTGGACTGG + Intronic
1194927068 X:99837465-99837487 CCATAAAGAAAATATTAGAATGG - Intergenic
1195159974 X:102161756-102161778 ACATTTAGGGACTACTGGAAAGG - Intergenic
1195510931 X:105714278-105714300 CCATAAAGAGAATTCTGACAAGG - Intronic
1196202782 X:112904628-112904650 ACATAATGAGAATACCAGAAAGG + Intergenic
1196593385 X:117515158-117515180 AAATAAAGAGTATAATGCAATGG + Intergenic
1197196462 X:123707176-123707198 ACATACAGAAAAAACTGGAAAGG - Intronic
1197806482 X:130402854-130402876 ATATAAAGTGAATACAGTAATGG - Intronic
1197919298 X:131573979-131574001 ACCTTAAAAGAATACTGAAATGG + Intergenic
1198121390 X:133595808-133595830 ACATAAAGACAAGAGTGGTAGGG - Intronic
1201181560 Y:11352604-11352626 AGGGAAAGAGAAGACTGGAACGG + Intergenic
1201426904 Y:13861373-13861395 AAATAAAGGGAATAGTAGAAAGG + Intergenic
1202019248 Y:20448207-20448229 TCAGAAATAGAATGCTGGAAGGG - Intergenic
1202039167 Y:20664809-20664831 AAGTAAAGAGAATAAGGGAATGG - Intergenic
1202039191 Y:20664979-20665001 AAATACAGAGAAATCTGGAAAGG - Intergenic
1202119158 Y:21506784-21506806 ACATGAAGAGTATACAAGAAGGG + Intergenic
1202121610 Y:21530324-21530346 ACATGAAGAGTATACAAGAAGGG + Intronic
1202157395 Y:21899058-21899080 ACATGAAGAGTATACAAGAAGGG - Intronic
1202159842 Y:21922599-21922621 ACATGAAGAGTATACAAGAAGGG - Intergenic
1202301571 Y:23421122-23421144 ACAGAAAGAAAATACAGAAAAGG + Intergenic
1202569240 Y:26249476-26249498 ACAGAAAGAAAATACAGAAAAGG - Intergenic