ID: 965485623

View in Genome Browser
Species Human (GRCh38)
Location 3:169274756-169274778
Sequence CTAGTGCTCAATAGCTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965485623 Original CRISPR CTAGTGCTCAATAGCTACAT AGG Intronic
903101148 1:21030765-21030787 CAAGTGCTCAAAAGCCACAGTGG + Intronic
903622289 1:24706612-24706634 CAAGTGCTCAATAGACACACGGG + Intergenic
903981372 1:27191021-27191043 CATGTGCTCATTAGCCACATTGG + Intergenic
905529391 1:38664643-38664665 CAATTGCTCAATAGCCACATGGG - Intergenic
907947106 1:59145945-59145967 CAAATGCTTAATAGCCACATTGG - Intergenic
908854558 1:68410403-68410425 CAAGTGATCAGTAGCTACACTGG + Intergenic
909072534 1:71013939-71013961 CAAGTACTCAATAGCTGTATAGG - Intronic
909404970 1:75278070-75278092 CAAGTGCTGAATAGACACATGGG - Intronic
912143671 1:106763715-106763737 ATAGTATGCAATAGCTACATTGG - Intergenic
912354559 1:109043964-109043986 CTAGTGCTCAATAGCATAATTGG + Intergenic
915744226 1:158143764-158143786 CCAGTGTTCAATAGCTCCATTGG + Intergenic
915744902 1:158148394-158148416 CTAGTTCTTAATAGGCACATGGG - Intergenic
916821336 1:168401489-168401511 CTAGTGCTCTATAACTAATTTGG + Intergenic
917327540 1:173848453-173848475 CAAGTGTTCACTAGCGACATTGG - Intronic
917867769 1:179213631-179213653 CAAGTGCTCAAGAGCCACAGTGG + Intronic
918053336 1:180994743-180994765 CTAGTGCTCAATAGATCAGTAGG + Intronic
918227164 1:182494403-182494425 CAAGTGCTCAGTGGCCACATGGG - Intronic
918776824 1:188642775-188642797 CTGTTGCTCAATTGCCACATGGG - Intergenic
920287704 1:204892569-204892591 CAAGTGCTCAATAGTCACATGGG - Intronic
921099623 1:211917135-211917157 CTTGTGCTAGATAGTTACATTGG - Intergenic
924405357 1:243739527-243739549 CAAGTGCTCAACAGCCACTTTGG + Intronic
924800644 1:247327759-247327781 ATAGTGCTCTATAGGTACAATGG - Intronic
1065401172 10:25303266-25303288 CAAATGCTCAATAGCTGCAGTGG + Intronic
1067791877 10:49294511-49294533 CAAGTGCTCATTAGCCACATAGG + Intergenic
1069231501 10:66014661-66014683 CAAGTACTCAGTAGCTACATTGG - Intronic
1069879404 10:71582262-71582284 CAAGTGCCCAGTAGCTACATGGG - Intronic
1072414330 10:95234200-95234222 CAAGTGCTCAGTAGACACATGGG - Intergenic
1075335572 10:121606797-121606819 CAAGTGCTCAACAGTCACATGGG + Intergenic
1075874113 10:125792454-125792476 CTAGTGCTCACTAGCCACAGTGG - Intronic
1075908074 10:126099803-126099825 CAAATGTTCAATAGCTACATTGG + Intronic
1076008313 10:126965934-126965956 CTAGTGATCTATAGCTCCTTAGG - Intronic
1080610340 11:33898714-33898736 AAAGTGCTCAATAGCCACATGGG + Intergenic
1081133664 11:39410882-39410904 CTAGTGCTCAGTAGCACAATAGG + Intergenic
1085133067 11:74058889-74058911 CAAGTGCTCGATAGCCACATGGG + Intronic
1085494946 11:76960574-76960596 CAAGTGCTCAGTAGCCACATTGG + Intronic
1086251151 11:84815921-84815943 CTATTGGGCAATTGCTACATTGG - Intronic
1086288909 11:85282280-85282302 CTAGTGCTCAGTAGCACAATAGG + Intronic
1089913702 11:122130029-122130051 CTAGTACTCAATAGCATAATAGG + Intergenic
1090004198 11:122985446-122985468 CAGGTGCTCAATAGCCACATAGG + Intergenic
1090595687 11:128318934-128318956 CTTGAGCTCAATAGCTAAAGGGG - Intergenic
1093301444 12:17463083-17463105 CTAGTACCCAATAGTTATATTGG + Intergenic
1095205799 12:39439671-39439693 CAAGCGCTTAATAGCCACATGGG + Intronic
1095449506 12:42315082-42315104 CAAGTTCTCAGTAGCCACATTGG - Intronic
1098683660 12:73391737-73391759 CTATTGATCAATAAGTACATTGG - Intergenic
1101232862 12:102759077-102759099 CGAGTGCTCAAGAGCCACATGGG + Intergenic
1107733228 13:43369712-43369734 CTTGTCCTCAATAGCTATAATGG + Intronic
1108073786 13:46657833-46657855 CTACTTCTTAATAGCTAAATAGG + Intronic
1108474788 13:50803489-50803511 CAAGTGTTCAAGAGCCACATGGG - Intronic
1109005323 13:56868318-56868340 CAAGTGGTCAATAGCCACACAGG - Intergenic
1109036125 13:57262830-57262852 ATAGTGCTCAAAAGCCAAATTGG - Intergenic
1110240512 13:73261197-73261219 CAAATGCTCAACAGCCACATGGG - Intergenic
1110245302 13:73316635-73316657 CTAGTGTTCAATAGCACAATAGG + Intergenic
1110297427 13:73884673-73884695 CAAATGCTCAGTAGCCACATGGG - Intronic
1110555245 13:76852457-76852479 CAAGTGCCCAATAGCCACATTGG + Intergenic
1115270565 14:31547567-31547589 CTAGTGTTCAGTAGCAACATAGG - Intronic
1115674193 14:35650905-35650927 CAAGTGCTCAATAGCCATATGGG - Intronic
1115789887 14:36866734-36866756 CAAATGCTCCATAGCCACATGGG - Intronic
1116080864 14:40169875-40169897 CAAGTGTTCAATAGCCACATTGG - Intergenic
1116283020 14:42932979-42933001 CTAGTGTTCAGTAGCAAAATAGG + Intergenic
1116555315 14:46296131-46296153 CTAGTGTTCAATAGCAAAATAGG - Intergenic
1117268157 14:54112655-54112677 CTAGTGTTCTATAGCACCATAGG + Intergenic
1117438381 14:55739038-55739060 CAAGTGCTCAGTAGCCACATGGG - Intergenic
1117687722 14:58271939-58271961 CCAGGGCTAAATAGTTACATTGG - Exonic
1118710379 14:68513861-68513883 CAAGGGCTGAATAGCAACATGGG + Intronic
1120166005 14:81200673-81200695 CTAGTACTAACTAGTTACATAGG + Intronic
1120572536 14:86139332-86139354 CTAGTGTTCAATAGCAAAGTAGG + Intergenic
1124548984 15:30660249-30660271 GAAGCGCTCAATAGCTACAGTGG - Intronic
1127675615 15:61235531-61235553 CAAGTACTCAATAGCCACGTTGG - Intergenic
1127752392 15:62059254-62059276 CAAGTGCTCCACAGCTACAGTGG + Intronic
1131036121 15:89223075-89223097 CGAATGCTGAAAAGCTACATGGG - Intergenic
1135238810 16:20784296-20784318 CTAGTGTTCAATATCCATATAGG + Intronic
1135898824 16:26435985-26436007 CTAGTGCTCAGTAGCACAATAGG - Intergenic
1140834076 16:78777341-78777363 CAAGTGCTCAGTAGCTACATGGG - Intronic
1150318748 17:64192047-64192069 CAAGTGTTCAAAAGCCACATGGG + Intronic
1150319428 17:64199766-64199788 CAAGGGCTCAACAGCCACATAGG + Intronic
1152311194 17:79551006-79551028 CAAGTGTTCAGTAGCCACATGGG - Intergenic
1153343199 18:3997926-3997948 CAAATGCTCAGTAGCCACATGGG + Intronic
1156844729 18:41651931-41651953 CAAGTGCTCAATAGCTACTGTGG + Intergenic
1157335729 18:46736237-46736259 CCAGTGCTCAGTAGTCACATGGG + Intronic
1157674107 18:49555777-49555799 CAAGTGCTCAGTAGCCACAGGGG + Intergenic
1158120023 18:54038764-54038786 CAAGTGCTAAATAGCCCCATGGG + Intergenic
1158287721 18:55903272-55903294 CAAGTACTCAGTAGCCACATAGG - Intergenic
1162601171 19:11670914-11670936 CTAGAGATCAATAGCTGCGTTGG - Intergenic
1163514022 19:17752166-17752188 CCAAGGCTCAGTAGCTACATGGG - Intronic
926831995 2:16973472-16973494 CAAGTGTGCAATAGCTGCATCGG - Intergenic
927022922 2:19036049-19036071 CAAGTGCTCAATAGTCACATAGG + Intergenic
927338564 2:21953436-21953458 TTACTGCTCAGTACCTACATTGG - Intergenic
927367176 2:22311084-22311106 CTAGTGTTCTATAGCTCTATAGG + Intergenic
928376941 2:30782954-30782976 CAAGTGCTCAATAGCCACACGGG + Intronic
931896064 2:66731044-66731066 CGAATGCTCCATAGCCACATGGG - Intergenic
932414855 2:71567510-71567532 CAAATGCTCGGTAGCTACATGGG + Intronic
933025079 2:77246525-77246547 TAAATGCTCAATAGCCACATGGG + Intronic
935681973 2:105645865-105645887 CTAGTGCACACCTGCTACATAGG + Intergenic
937778238 2:125806887-125806909 TTACTTCTCATTAGCTACATGGG - Intergenic
937907631 2:127060019-127060041 CAAGTGCTCAATAGCCCCATGGG + Intronic
939928807 2:148206523-148206545 CTAGGGTTCAATAGCAAAATAGG - Intronic
940256663 2:151738250-151738272 TGAGTGTTCAATAGCCACATGGG - Intergenic
940984825 2:160042552-160042574 CTAAAGCTCAATAGATTCATAGG + Intronic
943115425 2:183664002-183664024 CAAATGCTCAATAGCCACATGGG + Intergenic
943322394 2:186461698-186461720 CAAGTGCTCAATGGCCACAGGGG - Intergenic
943361940 2:186930260-186930282 CTAGTACTCAATAGCACTATAGG - Intergenic
944247122 2:197542938-197542960 CAAGTGCTACACAGCTACATGGG - Intronic
945274164 2:207971344-207971366 CTAGTGTTCAATAGCACTATAGG + Intronic
945433384 2:209791926-209791948 CAAGTGTTCAATAGCCACATGGG - Intronic
946615498 2:221505123-221505145 CAAGTGCTCAGTAACCACATGGG - Intronic
946793742 2:223327920-223327942 CTATTGATCCATAGCTACTTGGG - Intergenic
948112376 2:235466472-235466494 CAAGTGCTCAAGAGCCACATGGG + Intergenic
1169036004 20:2452585-2452607 CTAGTGATCAAGAGCAACTTGGG - Intergenic
1169526265 20:6429325-6429347 GCAGTGCTCAAAAGCCACATGGG - Intergenic
1170619945 20:17987332-17987354 CAAATGCTCAATAGCTATAGGGG - Intronic
1170792881 20:19522070-19522092 CAAGTGCTCAATAGCTCCCATGG - Intronic
1171309746 20:24136456-24136478 CAAGTGCTTAACAGCTACGTGGG - Intergenic
1171838240 20:30177052-30177074 CTAGTGTTCAATAGCACAATAGG - Intergenic
1172586666 20:36090202-36090224 CAAGTGCTCAATAGCCACAGAGG + Intergenic
1173035751 20:39408245-39408267 TTACTGCTCAATAGCTATTTTGG - Intergenic
1173261958 20:41444367-41444389 TAAGTGCTCAATAGCCACACAGG + Intronic
1173466788 20:43289570-43289592 CAAGTGCTCAATAGTCACACTGG + Intergenic
1173905933 20:46628767-46628789 CAGGTGCTCAACAGCCACATGGG + Intronic
1175468077 20:59206487-59206509 CAAATGCACAATAGCTACATGGG + Intronic
1179377033 21:40859287-40859309 CAAGTGCTCAGTAGCCACAATGG + Intergenic
1180887206 22:19254850-19254872 CTATTGGACATTAGCTACATGGG - Intronic
1182670730 22:31993540-31993562 CAAGTGCTCAGTAGCCACATAGG - Intergenic
1184336992 22:43859792-43859814 CAGGTGCTCAGTAGCCACATGGG - Intronic
950035041 3:9879109-9879131 CAAATACTCAATAGCCACATGGG - Intronic
951652915 3:24972063-24972085 CTGGTGTTCAATAGATCCATAGG - Intergenic
952490200 3:33863345-33863367 CTAGTGTTTAATAGCAGCATAGG - Intronic
952817316 3:37456921-37456943 CAAGTACTCAGTAGCCACATGGG + Intronic
953681571 3:45042735-45042757 CCATTGCTCAATAGCTAGAGTGG - Intergenic
956152559 3:66258959-66258981 CAAGTGCTCCATAGCTGCATGGG + Intronic
956614254 3:71155514-71155536 CAAGTGCTCAAGAGCCCCATGGG + Intronic
956614872 3:71160654-71160676 CAGGTGCTCCATAGCTACATTGG + Intronic
956813030 3:72883211-72883233 CAAGTGCTCCACAGCCACATGGG + Intergenic
957456275 3:80452386-80452408 CAAGTGCTTAATTGCTGCATGGG + Intergenic
960855664 3:122099797-122099819 CAATTGCTCAATAGCCACAGGGG + Intronic
961906843 3:130271708-130271730 CAAATGCTCAACAGCCACATGGG + Intergenic
963535863 3:146527255-146527277 CTAGTGTTCTATAGCTATGTAGG + Intronic
965485623 3:169274756-169274778 CTAGTGCTCAATAGCTACATAGG + Intronic
967466120 3:189807949-189807971 CCAGTGCTCAGTAGCTGCTTAGG - Intronic
967597488 3:191344362-191344384 CTAGTGCTAAATAGCCATATGGG - Intronic
968265762 3:197362084-197362106 CAAGTGTTCAATAGCAAAATGGG + Intergenic
977369818 4:96121403-96121425 CTAGTGGTCAGAAGCAACATAGG + Intergenic
978308482 4:107358770-107358792 TAAGTGTTCAATAGCCACATAGG + Intergenic
980695502 4:136350152-136350174 CTAGTGTTCAATAGCACTATAGG + Intergenic
981150372 4:141373340-141373362 CTAGTACAAAATAGCCACATAGG - Intergenic
981221207 4:142237579-142237601 CAAGTAATCAATAGTTACATGGG + Intronic
983380359 4:166983551-166983573 CTAGTGTTCTATAGCTGCATGGG + Intronic
983857052 4:172659441-172659463 CTAGTGTTCAGTAGCACCATAGG - Intronic
984036865 4:174679920-174679942 CTAGTGTTCAATAGCATAATGGG + Intronic
984673489 4:182519073-182519095 CAAGTGCTTGATGGCTACATTGG - Intronic
987631956 5:20484861-20484883 CTAGTGTTCAATAGCACAATGGG + Intronic
988709249 5:33756924-33756946 CAAGTGCTCAACAGCTGCATGGG - Intronic
988973704 5:36494522-36494544 CAAGTGCTCAATAGCTACATTGG + Intergenic
992649553 5:78844950-78844972 CTAGTGCTCTATAGCACTATAGG - Intronic
992975553 5:82114925-82114947 CAAGTGCTTAATATCTACATGGG - Intronic
993298718 5:86179427-86179449 CTAGTGCTGAAGAGCTCCAAAGG - Intergenic
993522976 5:88927758-88927780 CAAGTGCTCAATAGCACCATGGG - Intergenic
993812633 5:92501295-92501317 CAAGTGGTCAATAGCCACAGTGG - Intergenic
994618792 5:102138112-102138134 CTATTGCTCAAAATCTACAGTGG + Intergenic
998470761 5:142382099-142382121 CTAGGGCTCAACAGCAACTTGGG + Intergenic
1000717170 5:164659577-164659599 CTAGTGGTAAATTTCTACATAGG + Intergenic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1003024724 6:2543935-2543957 CAAGTACTCAATAGCCACATGGG - Intergenic
1004853618 6:19726355-19726377 CTAGTACTCAGTAGCTACACAGG + Intergenic
1006736213 6:36274805-36274827 CTAGTGGTCAATAAGTACATGGG - Intronic
1007237937 6:40404525-40404547 CAAGTGCTCAGTAGTCACATGGG + Intronic
1008043399 6:46827086-46827108 CAAGCACTCAATAGCCACATAGG + Intronic
1010759380 6:79705152-79705174 CAAGTGCTCAACAGCTATATAGG - Intergenic
1012162694 6:95906401-95906423 CCAGAGCTCAATAGCAAAATTGG - Intergenic
1013439678 6:110150501-110150523 CAAGTGCTCAATAGCCATACTGG + Intronic
1013754881 6:113449610-113449632 CAAGTGCTCAATAGCCACGTGGG + Intergenic
1013837735 6:114352310-114352332 CTAGTGTTTCATAGCTACATGGG - Intergenic
1014492094 6:122075265-122075287 TTAGTGCACAATAGCTTCTTTGG + Intergenic
1015002449 6:128234934-128234956 CTAGTGTTCAGTAGCACCATAGG + Intronic
1015071668 6:129101663-129101685 CAAGTACTCAGTAGCCACATGGG + Intronic
1017695939 6:157016342-157016364 CAAGTGCTCAACAGCCACACTGG - Intronic
1020475551 7:8589948-8589970 CAAGTGCCCAATAACCACATGGG + Intronic
1020571046 7:9861877-9861899 CTAGTGTTCAGTAGCACCATAGG + Intergenic
1020683511 7:11265843-11265865 CGAATGCTCAATAGCCACTTAGG + Intergenic
1021035084 7:15787864-15787886 CTACTTCTCAATAATTACATTGG + Intergenic
1022134378 7:27433677-27433699 TTAGTGCTCAATAGCAATTTGGG + Intergenic
1025222655 7:57128552-57128574 CTAATGTTCAACAGCTACAATGG + Intronic
1025633444 7:63300223-63300245 CTAATGTTCAACAGCTACAATGG + Intergenic
1025649252 7:63447934-63447956 CTAATGTTCAACAGCTACAATGG - Intergenic
1027569710 7:79848702-79848724 CAAGAGCTCAATAGCTACATGGG - Intergenic
1027953108 7:84844971-84844993 ATAGTGTTCAATAGCCACAGAGG - Intergenic
1028091849 7:86712555-86712577 CTAGTGTTCTATAGATATATAGG - Intronic
1028866441 7:95719204-95719226 CTAGGGCTCACTAGCAACTTTGG + Intergenic
1029282641 7:99446380-99446402 CAAGTGCTCAGTAGTCACATGGG + Intronic
1031175984 7:118350852-118350874 CAAGTGCTCAGCAGCCACATGGG - Intergenic
1031828564 7:126597987-126598009 CTAGTGTTCAATAGCACTATAGG - Intronic
1032495464 7:132358416-132358438 CTACTGCTCTCTAGCTACACTGG - Intronic
1032765966 7:134993993-134994015 CAAGTGTTCAGTAGCCACATGGG + Intronic
1033657745 7:143384446-143384468 CCAGTGCTCAAGAGCTCCTTGGG - Intronic
1037101146 8:15048402-15048424 CTAGTGTTCAATAGCTCAGTAGG + Intronic
1037277448 8:17196287-17196309 CAAGCGCTCAACAGCCACATGGG - Intronic
1037696708 8:21230026-21230048 TCAGTGCCCAGTAGCTACATGGG - Intergenic
1038131513 8:24737141-24737163 CAAGAGCTCAAAAGCTACAAAGG - Intergenic
1038281045 8:26165033-26165055 CTAGTGTTCAGTAGCAAAATGGG + Intergenic
1039638193 8:39189680-39189702 CTAGTGTTCAATAGCAAAGTAGG - Intronic
1039668572 8:39566886-39566908 CAGGTGCTCAATAGCCACATAGG - Intergenic
1039687280 8:39817408-39817430 CTAGTGTTCTATAGCACCATAGG + Intronic
1042883400 8:73520239-73520261 CAGGTGCTCAGTAGCCACATGGG - Intronic
1047241812 8:123097135-123097157 CAAGTGCTCAATAATCACATGGG + Intronic
1047458824 8:125042344-125042366 CATGAGCTCAATAGCTACACAGG + Intronic
1047547225 8:125830264-125830286 CTAGTGTTCAATAGCACAATAGG - Intergenic
1047740376 8:127801791-127801813 CAAGTGCTCAATACCCACATAGG - Intergenic
1047837775 8:128713011-128713033 CTATTGCTCAAAAGCAACAAGGG + Intergenic
1048033886 8:130658552-130658574 CTAGTGGCCAATGGCTACTTCGG + Intergenic
1049380249 8:142309853-142309875 CTAGACCTCAATAGCTGTATGGG - Intronic
1051143652 9:14004621-14004643 ATAGTGGTGAATAGCTTCATCGG - Intergenic
1051543283 9:18245420-18245442 CAAGTGCTCCATAGCTACTCGGG + Intergenic
1052340785 9:27362288-27362310 CTACTGCTTACTAGCTACATAGG - Intronic
1053308196 9:36998583-36998605 CAAGTGCACAGTAGCTACATAGG - Intronic
1054765504 9:69039364-69039386 CTAGTGCTCAGTAGCCACGGGGG + Intronic
1054842361 9:69756962-69756984 CAATTGCTCAATAGCTACTATGG + Intronic
1054874132 9:70077448-70077470 CTACTGCTCAATAGCCCCATTGG - Intronic
1056194497 9:84216075-84216097 AAAGTGCTCAATAGCCATATGGG - Intergenic
1059304481 9:113343021-113343043 CAAGTGCTCAATAGCTAGTAGGG - Intergenic
1186381596 X:9066476-9066498 CTAGTGCTCTATAGCACTATGGG + Intronic
1186648622 X:11534909-11534931 CAAGTGCCCAACAGCTCCATGGG + Intronic
1188339717 X:28984251-28984273 TTAATGATAAATAGCTACATGGG + Intronic
1188350438 X:29123749-29123771 CAAGTGCTCAACAGCCACATGGG - Intronic
1189052400 X:37660146-37660168 CAAGTGCTCAGTATCTACATTGG + Intronic
1193902513 X:87199600-87199622 CTGGAGCCCAATAGCTTCATTGG - Intergenic
1194305900 X:92247874-92247896 ATAATGCACAATAGCTACAGAGG - Intronic
1194881751 X:99261003-99261025 CTAGAGCCCAATAGCTTCACTGG - Intergenic
1195830111 X:109047654-109047676 CTAGTTCTCAAGAACAACATAGG - Intergenic
1196384715 X:115137111-115137133 CTAGTGTTCAGTAGCACCATAGG - Intronic
1196469030 X:116004713-116004735 CTAGTGCTCTATAGCACTATAGG - Intergenic
1196842242 X:119869673-119869695 CAAGTGCTCAATAGCCACCTGGG + Intergenic
1198471405 X:136950349-136950371 CAAGTGCTGAAGAGCCACATAGG + Intergenic
1199943656 X:152648794-152648816 CTAGTCCCCAATACCCACATAGG + Intronic