ID: 965486492

View in Genome Browser
Species Human (GRCh38)
Location 3:169284747-169284769
Sequence CACCTTTGACTCCTAGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965486492 Original CRISPR CACCTTTGACTCCTAGTGAT GGG (reversed) Intronic
903524913 1:23986366-23986388 CACCTTTGCCTCAAAGTGTTGGG + Intergenic
904189500 1:28732688-28732710 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
906416119 1:45622373-45622395 CACCTTTGACCTCTGGTGACTGG + Intronic
906670827 1:47653331-47653353 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
907206286 1:52774676-52774698 CACCTTGGCCTCCTAGTTTTGGG + Intronic
908953358 1:69589670-69589692 GAACTTTTAATCCTAGTGATGGG + Intronic
909031451 1:70545837-70545859 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
909446470 1:75754456-75754478 CACCTTGGCCTCCCAGTGTTGGG + Intronic
909626831 1:77726394-77726416 CACCTTGGCCTCCCAGTGTTGGG - Intronic
909934377 1:81533801-81533823 CCCCTTGGACTCCTAGTGTGAGG - Intronic
910876006 1:91878859-91878881 GACATTGGACTCCTAGTGAAGGG - Intronic
915122196 1:153636306-153636328 CACCTTGGCCTCCCAGTGTTGGG - Intronic
917863564 1:179171759-179171781 CACCTTGGCCTCCCAGTGCTGGG + Intronic
919746962 1:201014660-201014682 GACCTTGGACTCCTAGGGGTTGG + Intronic
1064029326 10:11873785-11873807 CACCTCTGCCTCCTAGTAACTGG - Intergenic
1064542914 10:16423335-16423357 CGCCTTTGCCTCCCAGTGCTGGG - Intergenic
1068445806 10:57120975-57120997 CACATTTGACTAGCAGTGATTGG + Intergenic
1068915773 10:62429809-62429831 CAATTGTGACTCCTAGTGGTAGG - Intronic
1072232824 10:93427282-93427304 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1072924875 10:99608337-99608359 CCCCTTTGACCTCTAGTGACTGG + Intergenic
1072978590 10:100080642-100080664 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1073324958 10:102638317-102638339 CACCTTGGACTCAGAGTGCTGGG - Intergenic
1074054359 10:109908866-109908888 GACTTTTGACTCCTAGTGGACGG - Intronic
1074168142 10:110904650-110904672 CAATTTTGACTCATAGTAATTGG + Intronic
1077778506 11:5298186-5298208 CACCCTGGCCTCCTAATGATAGG - Intronic
1078001404 11:7499636-7499658 CATCTCTGACTCCAAGTGCTGGG + Intronic
1079009667 11:16817556-16817578 CACATTGCACTCCAAGTGATGGG - Intronic
1080373679 11:31682280-31682302 CACCTATGAGTCTTATTGATGGG - Intronic
1083447106 11:62715397-62715419 CAGCTCTGGCTCCAAGTGATGGG - Intronic
1085071137 11:73547034-73547056 CACCTTGGCCTCCCAGTGCTAGG - Intronic
1085280615 11:75327835-75327857 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1088067183 11:105733702-105733724 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1090128869 11:124118424-124118446 CCCCTTTGAATTCTAGTGGTGGG + Intronic
1091499833 12:1005389-1005411 CACCTTGGCCTCCGAGTGTTGGG + Intronic
1092524045 12:9298670-9298692 CTCCTTTGCCTTCCAGTGATGGG - Intergenic
1092543225 12:9433144-9433166 CTCCTTTGCCTTCCAGTGATGGG + Intergenic
1093015147 12:14147926-14147948 CACCTTGGACTCCTTGTGTTTGG + Intergenic
1095769236 12:45933809-45933831 CATCTTTGAATCCTAGTGACTGG - Intronic
1096144749 12:49270730-49270752 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1096738447 12:53674696-53674718 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1098437747 12:70486007-70486029 CACCTGTGATTCCTGGTGATGGG - Intergenic
1098887260 12:75972945-75972967 CACCTTGGCCTCCCAGTGTTTGG + Intergenic
1100939101 12:99705758-99705780 CACCTTCTACTCCTTCTGATAGG - Intronic
1101642974 12:106601774-106601796 GACCTGTGACTCCCAGTGGTGGG - Intronic
1101912071 12:108867386-108867408 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1102479232 12:113209632-113209654 CACCTTAGCCTCCCAGTGCTGGG + Intronic
1103576442 12:121881039-121881061 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
1103637144 12:122316456-122316478 CACCTCAGCCTCCCAGTGATGGG + Intronic
1104865600 12:131951429-131951451 CGCCTTGGCCTCCTAGTGCTGGG + Intronic
1105939771 13:25137362-25137384 CTCCTTTGACTGCTAGGGAAAGG - Intergenic
1107593181 13:41930599-41930621 CACATTTGACTGCATGTGATAGG + Intronic
1108136880 13:47374002-47374024 CACATTTGACTTCATGTGATAGG - Intergenic
1108650409 13:52472794-52472816 CACCTTGGACTTCTGGTGTTGGG - Intronic
1112315750 13:98360727-98360749 CATCTTTGAATCCTACTGATGGG + Intronic
1113093800 13:106641616-106641638 CACCGTTGACTCCTTCTGAGGGG - Intergenic
1117903364 14:60558971-60558993 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1120746804 14:88159557-88159579 GACCTTTGGCTCCCAGTGAAGGG - Intergenic
1123700388 15:22910408-22910430 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1125660171 15:41387863-41387885 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1126594041 15:50368327-50368349 CACCTCGGCCTCCTAGTGCTGGG - Intergenic
1129080117 15:73032223-73032245 CACCTTTAACTCTTAGAGACAGG - Intergenic
1129449343 15:75641572-75641594 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1129526581 15:76220314-76220336 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1130009276 15:80135873-80135895 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1131423200 15:92324674-92324696 CTCCTTAGACTCCTTGTTATAGG - Intergenic
1132056499 15:98654334-98654356 CACCTGTGACTCCTAATTTTTGG - Intronic
1138575989 16:57907684-57907706 CCCCTCTGCCTCCTTGTGATGGG + Intronic
1138870232 16:60874440-60874462 CACCTGTGAGTGCTAGAGATAGG - Intergenic
1139878587 16:70165786-70165808 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1140339329 16:74141513-74141535 CACCTCAGCCTCCTAGTGTTGGG - Intergenic
1140358973 16:74329028-74329050 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
1140373925 16:74429706-74429728 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
1141635458 16:85311791-85311813 CACCTTGCAGTCCTGGTGATGGG + Intergenic
1143789121 17:9279335-9279357 CACCTTAGCCTCCCAGTGTTGGG + Intronic
1147317843 17:39629304-39629326 CAGCTTTGACTCCTGTTCATGGG - Intronic
1147752765 17:42746429-42746451 CACCTCTGCCTCCCAGTGCTGGG + Intergenic
1148051236 17:44770864-44770886 CACCTCAGCCTCCCAGTGATGGG - Intronic
1149485276 17:57037777-57037799 CACCTCTGCCTCCCAGTGTTGGG + Intergenic
1150136688 17:62699654-62699676 CACCTCTGCCTCCCAGTGCTGGG + Intergenic
1150681350 17:67287038-67287060 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1152183906 17:78842038-78842060 CACCTTGGCCTCCAAGTGTTGGG - Intergenic
1152464154 17:80456374-80456396 CTCCTTTGATTACTAGTGCTGGG - Intergenic
1153322472 18:3786624-3786646 CACCTGTGACTGCAGGTGATTGG - Intronic
1156410747 18:36826273-36826295 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1158581969 18:58691618-58691640 CACCTCAGACTCCCAGTGTTGGG - Intronic
1160836843 19:1128718-1128740 CACCTTGGCCTCCAAGTGCTGGG - Intronic
1161817415 19:6508179-6508201 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1162297401 19:9822746-9822768 CACCTTGGTCTCCCAGTGTTGGG + Intronic
1163174970 19:15557968-15557990 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1163778769 19:19234119-19234141 CACCTCTGACTGGTAGTAATGGG - Intronic
1165790365 19:38487880-38487902 CACCTTGGCCTCCCAGTGTTAGG + Intronic
1166665037 19:44674416-44674438 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1167728373 19:51234751-51234773 CACCTTTGACCCTAAGTGATGGG + Intronic
927558959 2:24055456-24055478 CACCTTGGCCTCCTAGTGCTGGG + Intronic
930238594 2:48911834-48911856 CACCTTGGCCTCCCAGTGCTGGG - Intergenic
935173191 2:100626605-100626627 CACCGTGGACTCCTAGAGATGGG - Intergenic
935317877 2:101855190-101855212 CACCTTTTACACCTGTTGATGGG + Intronic
937419680 2:121743329-121743351 CACCTTGGCCTCCCAGTGTTGGG + Intronic
938593937 2:132767492-132767514 CGCCTTGGCCTCCTAGTGCTGGG + Intronic
939008356 2:136816131-136816153 CACCTTGGCCTCCAAGTGCTGGG + Intronic
940265391 2:151830460-151830482 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
940939301 2:159539619-159539641 AGCCTTTGACTCCAAGTGCTGGG - Intronic
941867982 2:170354577-170354599 TACTTTTGACTCCTATTGTTAGG - Intronic
941984948 2:171500902-171500924 CACCTTAGGCTCCTAGTAGTTGG - Intergenic
946358557 2:219204998-219205020 CACCTTGGCCTCCGAGGGATGGG + Intronic
947911058 2:233801300-233801322 CACCTTCAACTCCTAGGGGTGGG + Intronic
1170209493 20:13834524-13834546 CACCTTTGCCTCAAAGTGTTGGG + Intergenic
1171202452 20:23253010-23253032 TACCTTTTATTCCTAGTTATAGG - Intergenic
1176968004 21:15233359-15233381 CCACTTTGACTACTATTGATTGG + Intergenic
1178621223 21:34178293-34178315 CACCTTTGCATCCTACTGCTTGG + Intergenic
1183941598 22:41298747-41298769 CACCTCGGCCTCCTAGTGTTGGG + Intergenic
951559659 3:23953086-23953108 CACCTTGGCCTCCCAGTGCTGGG - Intronic
951886990 3:27534051-27534073 CAGCTTGGCCTCCTGGTGATGGG + Intergenic
951965674 3:28381912-28381934 CACCTTGGCCTCCTATTGCTGGG - Intronic
954791656 3:53137580-53137602 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
959293770 3:104509179-104509201 CACCTCAGCCTCCTAGTGTTGGG - Intergenic
962746586 3:138401528-138401550 CACCTTTGCCTCTGAGTGCTGGG - Intronic
963264715 3:143228739-143228761 CACCTTTTACTCCTTCCGATGGG - Intergenic
964031168 3:152140633-152140655 CACCTTAGACTCCAAGAGCTGGG - Intergenic
965486492 3:169284747-169284769 CACCTTTGACTCCTAGTGATGGG - Intronic
967917896 3:194592349-194592371 CACCCTTGCCTCCAAGTGACAGG - Intronic
968957904 4:3728411-3728433 CTCCTTGGACTCCCAGAGATGGG + Intergenic
971740086 4:30508174-30508196 GACCTGTGACTCCTAGCTATGGG - Intergenic
973030791 4:45335370-45335392 CACCCTTGACCTCTTGTGATGGG - Intergenic
975173109 4:71256006-71256028 CACCCTTGAATTCAAGTGATAGG + Intronic
975319133 4:72990153-72990175 CATCTTTGACTCTTAATTATAGG - Intergenic
975722584 4:77262599-77262621 CACATTAGAATCATAGTGATGGG - Intronic
976195980 4:82531504-82531526 CACCTTGGCCTCCCAGTGTTGGG - Intronic
976296970 4:83482458-83482480 CACCTTGGCCTCCCAGTGCTAGG - Intronic
976598581 4:86917027-86917049 CACCTTGGCCTCCCAGTGTTGGG - Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
982733141 4:158977860-158977882 CACCTCTGCCTCCCAGTGCTGGG + Intronic
984142070 4:176015525-176015547 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
984686567 4:182675291-182675313 CACCTTGGCCTCCTGGTGCTGGG - Intronic
986467257 5:8038010-8038032 CTCCTTTGACTCCATGTGTTGGG - Intergenic
989565112 5:42894173-42894195 CACCATTGACTCCTGGACATGGG - Intergenic
992896434 5:81249329-81249351 CACCTTTGCCTCCCAGTGCTGGG + Intronic
993561340 5:89414520-89414542 AACCTTTGGCTACTAATGATTGG + Intergenic
995164268 5:109020075-109020097 CAGATTTGACTCTTAATGATTGG + Intronic
996785991 5:127237244-127237266 CACCTTGGCCTCCCAGTGCTGGG - Intergenic
997280162 5:132637780-132637802 CACCTTGGCCTCCCAGTGTTGGG + Intronic
998120182 5:139570005-139570027 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1001660515 5:173388697-173388719 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
1002949016 6:1789786-1789808 CACCTCAGCCTCCCAGTGATGGG + Intronic
1003034159 6:2628515-2628537 CACCTCTTCCTCCTAGTGCTAGG - Intronic
1006543594 6:34760796-34760818 CACCTTGGCCTCCTAGTGCTGGG - Intronic
1008997218 6:57672946-57672968 CACCTCTTAATCCTAGAGATTGG + Intergenic
1015450259 6:133359270-133359292 CTCCTTTGACCCCTAGTCCTAGG + Intronic
1017050636 6:150390545-150390567 CAGCTGTGACTTCTAGTGTTGGG + Intronic
1017834088 6:158161125-158161147 CACCTTGGCCTCCAAGTGCTGGG - Intronic
1018111845 6:160544123-160544145 CACCTTTGACTCCCATGGAAGGG - Intronic
1018131413 6:160735353-160735375 CACCTTTGACTCCCATGGAAGGG + Intronic
1018156101 6:160986640-160986662 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1019561119 7:1658175-1658197 GACCTTTGACACATAGTGCTGGG + Intergenic
1020179055 7:5907107-5907129 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1020629878 7:10626595-10626617 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1023596099 7:41830602-41830624 CTCCTTTCACCCCTAGTGATGGG + Intergenic
1026914365 7:74111186-74111208 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1028288608 7:89036764-89036786 TACTTCAGACTCCTAGTGATTGG - Intronic
1030779731 7:113585256-113585278 CACCTCTGTCTCCCAGTGTTGGG - Intergenic
1031726491 7:125246446-125246468 CACCTTTGCCTCTCAGTGTTGGG - Intergenic
1031768558 7:125812123-125812145 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1031815735 7:126432857-126432879 CACATTTCACCCTTAGTGATAGG - Intergenic
1032913403 7:136459736-136459758 CATCTTTGACTCCTAGCAGTGGG - Intergenic
1038183012 8:25246525-25246547 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1039859451 8:41444479-41444501 CACCTTTGTCTACCAGTGCTTGG - Intergenic
1042801678 8:72724864-72724886 AACCTGTGACTTCTAGTAATGGG - Intronic
1043396000 8:79837421-79837443 TGCCTTGGACTCCTAGTGTTGGG - Intergenic
1044365901 8:91345195-91345217 AACCTCTGACTCCCAGTGTTGGG + Intronic
1047164169 8:122418356-122418378 CACCTTGGCCTCCTAGTGTTGGG - Intergenic
1049091452 8:140517653-140517675 CACCTCGGCCTCCCAGTGATGGG + Intergenic
1052300150 9:26944877-26944899 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1052561379 9:30088569-30088591 GACCTGTGAATCCTGGTGATGGG + Intergenic
1055506065 9:76950716-76950738 CACCTGTGACTGTTAGTGTTGGG - Intergenic
1058963532 9:110015348-110015370 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1059301043 9:113313812-113313834 CTCCTTTGATTCCTTGTTATGGG - Exonic
1059565896 9:115382687-115382709 CAGCTTTGCCTGCTTGTGATAGG + Intronic
1060491205 9:124085963-124085985 CACCTTTGACTGATGGTGACGGG - Intergenic
1060981055 9:127792214-127792236 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1061066584 9:128281822-128281844 CACCTTGGCCTCCCAGTGTTAGG - Intronic
1061933100 9:133843453-133843475 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1062300709 9:135866632-135866654 CACCTCTGACTCCTAGACATAGG + Intronic
1192763822 X:74123101-74123123 AACCTTTCACTGCTATTGATGGG + Intergenic
1196869925 X:120102993-120103015 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1198081571 X:133245106-133245128 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1199540711 X:148955212-148955234 TACCTTTGCCTCCTGGTGAGAGG + Intronic
1199769516 X:150965536-150965558 CACCTTAGCCTCCTAATGCTGGG + Intergenic