ID: 965489674

View in Genome Browser
Species Human (GRCh38)
Location 3:169320980-169321002
Sequence ACTTACCAGAAAATAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965489668_965489674 19 Left 965489668 3:169320938-169320960 CCAGTAACTGGATGAGAAATCTG 0: 1
1: 0
2: 0
3: 21
4: 149
Right 965489674 3:169320980-169321002 ACTTACCAGAAAATAACCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965489674 Original CRISPR ACTTACCAGAAAATAACCCA GGG Intronic
905822882 1:41007456-41007478 ACATGCCAGAACACAACCCAGGG + Exonic
906730681 1:48078268-48078290 ACTTCTCAGGAAATACCCCAAGG - Intergenic
909514321 1:76490129-76490151 CCTGACCCGAAAATAGCCCACGG + Intronic
909785284 1:79604518-79604540 ATTAACCAGCAAACAACCCAGGG - Intergenic
909881225 1:80881274-80881296 ACTGACAGGAAAATAACCTATGG + Intergenic
911274507 1:95844563-95844585 ACTCACTAGACAATACCCCATGG - Intergenic
913982209 1:143531006-143531028 TAGTACCAGAAAAGAACCCATGG - Intergenic
916614541 1:166426082-166426104 ACCAACCAAAAAAAAACCCAGGG - Intergenic
917174340 1:172215896-172215918 ATTTTCAAGAAAATAACTCAAGG - Intronic
918164533 1:181931864-181931886 CCTTACCAAAAAACAACACAGGG + Intergenic
919328861 1:196143358-196143380 ACTTTAAAAAAAATAACCCATGG + Intergenic
920281815 1:204849231-204849253 ACTTCACATAAAATAACTCAAGG - Intronic
923330943 1:232924145-232924167 GCTTGCCAGAAACCAACCCAAGG + Intergenic
923752567 1:236759773-236759795 TCTTACCAGGTCATAACCCATGG - Exonic
1062873291 10:925374-925396 ACTTAACAGAAAATAAAAAATGG + Intronic
1065268730 10:24004625-24004647 AGTGACCAGCAAATAACTCAAGG + Intronic
1065588670 10:27243429-27243451 ATTTACCAGCAAATCAGCCATGG - Intergenic
1065672931 10:28141667-28141689 ACTTAGCAGGAAATAGTCCAGGG + Intronic
1066575075 10:36816752-36816774 ATTTACCAGCAAATCAGCCATGG + Intergenic
1066951723 10:42125347-42125369 TAGTACCAGAAAAGAACCCATGG + Intergenic
1067741618 10:48899852-48899874 ACTTACCAGAAACTGAACTAGGG - Intronic
1069226092 10:65946162-65946184 ACTTACCAAAAAATCCTCCATGG - Intronic
1072492630 10:95922748-95922770 ACCGAGCAGAAAATAACACATGG + Intronic
1072540764 10:96396549-96396571 AACTACCAGAAAATTACCAAGGG - Intronic
1076084477 10:127613771-127613793 ACATACTTTAAAATAACCCATGG - Intergenic
1079397327 11:20076098-20076120 ATTTAGCTGAAAATAACCCTGGG + Intronic
1079589988 11:22170904-22170926 ACTAACAAGAAAATAACCAGAGG + Intergenic
1080265122 11:30392458-30392480 ACTTGTCTGAAAATAAGCCAGGG + Intronic
1080761863 11:35258542-35258564 ACTTACCAGAAAAAAGCTCTTGG + Exonic
1080812035 11:35714289-35714311 ACTTAACACAAAATAATACATGG - Intronic
1087553481 11:99683242-99683264 AGTTTCCATAAAATAACACAGGG - Intronic
1088954027 11:114599898-114599920 CCATATCAGAATATAACCCATGG + Intergenic
1089369742 11:117947008-117947030 ACTTCCCAGGAAATGACTCAGGG - Intergenic
1089839592 11:121404066-121404088 ACCTAACAGAAAATAGCCAAGGG + Intergenic
1096332763 12:50728857-50728879 AATTAACAGAAAATAACAAAGGG - Intronic
1100255540 12:92879617-92879639 GCTGATCAGAAAAAAACCCATGG + Intronic
1108388064 13:49919885-49919907 ATTTGCCTCAAAATAACCCAAGG + Intronic
1108835909 13:54547763-54547785 AACTATGAGAAAATAACCCAAGG + Intergenic
1112159097 13:96849687-96849709 ACATCCCTGAAAATAACCAATGG - Intergenic
1112160208 13:96859305-96859327 ACTGCCAAGAAAAGAACCCAGGG + Intergenic
1112271353 13:97973341-97973363 TCTTATAAGAAAATAACTCAGGG - Intronic
1113488894 13:110676846-110676868 TCTTCCCAAAAAATCACCCATGG + Intronic
1114551487 14:23535053-23535075 ACTTCCCACCAAATGACCCAGGG - Exonic
1115726965 14:36227612-36227634 ACTTCCCAGAAAATGACACTAGG - Intergenic
1116284001 14:42948487-42948509 ACTTGCCCGTAAATAACTCATGG + Intergenic
1117100090 14:52336627-52336649 CCTGACCATAAAATAACCAAAGG + Intergenic
1118951848 14:70442378-70442400 ACTTACCAGTACAAAAACCAGGG - Intergenic
1119018804 14:71087680-71087702 AGTTACCAAAAAATAATCCAGGG - Intronic
1120982789 14:90305786-90305808 ACTTACCAGAAAAGAGCACGAGG + Intronic
1122633659 14:103119790-103119812 ACGGACCAGAGAATAACACAGGG - Intergenic
1202937758 14_KI270725v1_random:107965-107987 TAGTACCAGAAAAGAACCCATGG + Intergenic
1123395453 15:19929922-19929944 TAGTACCAGAAAAGAACCCATGG - Intergenic
1126266845 15:46764971-46764993 ACCTATCAGAGAATAAGCCAGGG - Intergenic
1127416090 15:58758542-58758564 AATTTCCAGAAAGTAACACATGG - Intergenic
1133511008 16:6457400-6457422 AGTCACCAGAAAATAACACAAGG - Intronic
1136640803 16:31563661-31563683 ACTTACCAGAACAGCTCCCATGG + Intergenic
1136664162 16:31793653-31793675 ACTTACCAGAACAGCTCCCATGG - Intronic
1136935918 16:34464699-34464721 TAGTACCAGAAAAGAACCCATGG + Intergenic
1136945799 16:34649248-34649270 TAGTACCAGAAAATAACCCATGG - Intergenic
1136956135 16:34788281-34788303 TAGTACCAGAAAAGAACCCATGG - Intergenic
1136963902 16:34883871-34883893 TAGTACCAGAAAAGAACCCATGG - Intergenic
1137088535 16:36159113-36159135 TAGTACCAGAAAAGAACCCATGG - Intergenic
1137220149 16:46441218-46441240 TAGTACCAGAAAAGAACCCAGGG + Intergenic
1137562518 16:49511825-49511847 ACTTGACAGTAAATAAACCAAGG + Intronic
1137975488 16:53027844-53027866 ATTTACCAGAATATAATCCCAGG - Intergenic
1138144019 16:54592632-54592654 GCTTACCATAAAATACTCCAAGG + Intergenic
1138687115 16:58735097-58735119 AGTAAGCACAAAATAACCCATGG + Intergenic
1139925236 16:70482339-70482361 ACTGACCAGCAAACAGCCCAGGG + Intronic
1139970779 16:70773336-70773358 ACTTACCATCATATAACCCAGGG + Intronic
1140607477 16:76557665-76557687 ACTTAGCACAAATTAACGCAAGG - Intronic
1140664580 16:77215636-77215658 AGTTAGCAGAACAGAACCCAGGG + Intergenic
1141059491 16:80852754-80852776 ATTTACCAGAAAAAAAAACATGG + Intergenic
1143938178 17:10509032-10509054 ACTTACCAGAAAATATTTCTAGG + Intronic
1145708811 17:26948957-26948979 TAGTACCAGAAAAGAACCCATGG - Intergenic
1146180580 17:30695728-30695750 ACTTCCTGGAAAATAGCCCAGGG - Intergenic
1147483383 17:40788511-40788533 AAATAGCAGAAAATATCCCAAGG + Intergenic
1149061004 17:52421841-52421863 ACTTACCAGGGGATAACCCATGG + Intergenic
1151794019 17:76330132-76330154 AGTTATCAGAAAATAACACCTGG + Intronic
1153210545 18:2758768-2758790 ACCAACCACAAAATAACCAAAGG - Intronic
1154516355 18:15170849-15170871 ACATAGCAGGAAATAACACATGG + Intergenic
1155402132 18:25450599-25450621 ACTTACCATAACAGAAACCAAGG + Intergenic
1155404120 18:25468917-25468939 ACTTACTGTAAAATAACCCCCGG - Intergenic
1155724682 18:29065794-29065816 ACTTTCCTGTAAATAATCCAGGG + Intergenic
1155855928 18:30834218-30834240 TCTTACCAGAAAATTACTAAAGG + Intergenic
1156204993 18:34875609-34875631 ACTTACTAAAAAATAAGGCAGGG - Intronic
1158990360 18:62862510-62862532 GCTTACCAGAAAACAACTGATGG - Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1162194281 19:8972325-8972347 AGTCTCCAGAAAAAAACCCAAGG - Exonic
1162637998 19:11985328-11985350 ACTTCCCAGAAAATGGCCCCAGG - Intergenic
1167255023 19:48422123-48422145 GCATCCCAGAAAATATCCCAAGG - Intronic
925453552 2:3992652-3992674 AATAACAAGAAAACAACCCAAGG - Intergenic
925721377 2:6831112-6831134 ACTACCCAGAAAAAAACACAGGG + Intergenic
926763251 2:16298461-16298483 TCTTACCAAAAAATAAACCTGGG - Intergenic
926803537 2:16683732-16683754 ACTCAGCAGAAAACAACCAATGG + Intergenic
934249712 2:90339894-90339916 TAGTACCAGAAAAGAACCCATGG + Intergenic
934259863 2:91463552-91463574 TAGTACCAGAAAAGAACCCATGG - Intergenic
934303171 2:91795480-91795502 TAGTACCAGAAAAGAACCCATGG - Intergenic
934330088 2:92057276-92057298 TAGTACCAGAAAAGAACCCATGG + Intergenic
934468313 2:94287185-94287207 TAGTACCAGAAAAGAACCCATGG + Intergenic
936015578 2:108956563-108956585 TCTAACCAGAAAAGCACCCAAGG - Intronic
938519433 2:132052377-132052399 TAGTACCAGAAAAGAACCCATGG + Intergenic
939964750 2:148599314-148599336 ACTGACCAGAAGGTAACACAAGG - Intergenic
940218329 2:151323911-151323933 ATATACCAGAAAATACACCAAGG + Intergenic
941742622 2:169051875-169051897 TTTTACCAGAAATTAACCAAGGG - Intergenic
942245420 2:174003645-174003667 AAGTAACAGAAAATAACCAAGGG + Intergenic
943511709 2:188835162-188835184 ACATACTTGTAAATAACCCATGG + Intergenic
945185842 2:207138690-207138712 ACTTACTAGAATAAAACTCATGG + Intronic
945692689 2:213059433-213059455 CCTTACCAGAAAAAATACCATGG - Intronic
946684814 2:222257048-222257070 CCTTACCATAAAAGAGCCCATGG - Intronic
948293312 2:236843271-236843293 ACTTGGCAGAAAATCAGCCATGG + Intergenic
1169066021 20:2694364-2694386 ACCTACCAGAAAAACACCCGAGG - Intronic
1171315871 20:24194246-24194268 CCTTAGCAGAAAATAAGCCATGG + Intergenic
1175127986 20:56766727-56766749 ACAAAACAAAAAATAACCCAGGG + Intergenic
1175977803 20:62721372-62721394 ACTTAACAGAAAAAGAACCATGG - Intronic
1176585570 21:8581167-8581189 TAGTACCAGAAAAGAACCCATGG - Intergenic
1180268379 22:10558066-10558088 TAGTACCAGAAAAGAACCCATGG - Intergenic
1180525165 22:16251452-16251474 TAGTACCAGAAAAGAACCCATGG - Intergenic
1180730153 22:17975300-17975322 ACTTGCTAGAAAGTCACCCAAGG + Intronic
1185128092 22:49022814-49022836 TCTTACCAGAACAGAGCCCATGG - Intergenic
1203237432 22_KI270732v1_random:18516-18538 TAGTACCAGAAAAGAACCCATGG - Intergenic
1203290364 22_KI270735v1_random:31558-31580 TAGTACCAGAAAAGAACCCATGG + Intergenic
949808351 3:7978940-7978962 ATTTACTAGAAAGTAATCCAGGG - Intergenic
955665228 3:61343148-61343170 ACTTCCAAGAAAATGAACCAAGG + Intergenic
955794984 3:62626345-62626367 ACTAAACAGAAAAGAAACCATGG + Intronic
957808085 3:85177691-85177713 ACTTACAGTAAAATAACCCAAGG + Intronic
958492976 3:94801834-94801856 ACTTACCAAAATATGACACAGGG + Intergenic
958800285 3:98747101-98747123 TCTGGCCAGAAAATAATCCAAGG - Intronic
962696625 3:137954354-137954376 ACCTACCAAAAAAAAGCCCAGGG - Intergenic
963694887 3:148553972-148553994 ACTTAACACAAACTAACACAGGG - Intergenic
964979030 3:162656064-162656086 CCATACCATAAAATAACCAATGG + Intergenic
965489674 3:169320980-169321002 ACTTACCAGAAAATAACCCAGGG + Intronic
971893765 4:32562457-32562479 ACTGACCAGGAAATATCACAAGG - Intergenic
974585952 4:63877651-63877673 TCATACCAGAAAAAAACACATGG + Intergenic
974642765 4:64653419-64653441 ACTTACCACAAAATAATGCTAGG - Intergenic
975207518 4:71662281-71662303 ACTTGCCAGAAAACACTCCATGG + Intergenic
975715607 4:77202913-77202935 ATTTACCAGAAAAAAAGCCATGG - Intronic
977204267 4:94152411-94152433 ACAAACCTGAAAAAAACCCAGGG - Intergenic
979264401 4:118684627-118684649 TCTTAACTGAAAATAACCCAAGG - Intergenic
980737823 4:136913960-136913982 AGTTAGCAGATTATAACCCATGG + Intergenic
982132199 4:152239655-152239677 ACTTACCAGGAAATAACCTTAGG + Intergenic
982538130 4:156632185-156632207 TATTAATAGAAAATAACCCAAGG + Intergenic
982772404 4:159409044-159409066 TGTTGCCAAAAAATAACCCATGG + Intergenic
983625352 4:169796626-169796648 ACTTCTCTGAAAATATCCCATGG - Intergenic
983843947 4:172493156-172493178 ATTTACCAGAATTTAAGCCAAGG - Intronic
984959533 4:185082235-185082257 ACTGACCAAAAAATGACTCATGG + Intergenic
987162669 5:15160500-15160522 AATTACCAAAATATTACCCAAGG - Intergenic
987241197 5:16001531-16001553 TCTTGCCACAAAATAACACAGGG - Intergenic
988415765 5:30945280-30945302 ACTTAACAGAAATTAAGTCAGGG + Intergenic
989814242 5:45716909-45716931 ACTTAGCACAGAATAACCTATGG - Intergenic
991041239 5:62177913-62177935 TCTTTCCAGAAAACTACCCAAGG + Intergenic
991684064 5:69165926-69165948 AGTTACCTGAATAGAACCCAGGG + Intergenic
993112713 5:83678478-83678500 ACCTTACAGAAAATAAACCACGG - Intronic
993644725 5:90448091-90448113 ACTTTCTAGAAAGTAAACCAAGG - Intergenic
993680960 5:90877244-90877266 ACTAAACAGAACATAATCCAAGG - Intronic
993741242 5:91542919-91542941 ACTTACAATAAAATAACCCTGGG - Intergenic
993812902 5:92504842-92504864 AATTTGCAGAAAATAACCCAAGG + Intergenic
993815307 5:92537005-92537027 GTTTAACAGAAAGTAACCCAAGG + Intergenic
994151355 5:96451230-96451252 ACTTCCAAGAATCTAACCCAGGG + Intergenic
994587532 5:101728976-101728998 ACTTCCCAGAAAACATCCCCAGG + Intergenic
995653178 5:114395034-114395056 ACCTTCTAGAAAATAATCCAGGG - Intronic
996262377 5:121489475-121489497 ACTAAACAAAGAATAACCCAGGG - Intergenic
996580982 5:125032103-125032125 CATTACCAGAAAAGAATCCAAGG - Intergenic
998303852 5:141053306-141053328 TTTGAACAGAAAATAACCCAAGG - Exonic
1002306012 5:178283538-178283560 ACTTACAAGAGAATAAAACAAGG - Intronic
1003339296 6:5204315-5204337 CCTTTCCAGAAAAGAAGCCAAGG - Intronic
1006631327 6:35432124-35432146 AATTTCCAGAAAATAACACAGGG + Intergenic
1007011613 6:38423616-38423638 AGTTACCATAAAATGACCAAAGG + Intronic
1007468457 6:42072079-42072101 ACTTACAAGAAAATAGACTAAGG - Intronic
1011862271 6:91773973-91773995 ATTTACCAGAAAATCATTCAGGG - Intergenic
1011991417 6:93523428-93523450 ATTTAGCAAAGAATAACCCAAGG + Intergenic
1012723515 6:102779907-102779929 AGTTTACATAAAATAACCCAGGG - Intergenic
1012797453 6:103780766-103780788 ACTTCCCAGAAAATTAAACAAGG - Intergenic
1015194058 6:130506043-130506065 CCCAACTAGAAAATAACCCAAGG + Intergenic
1017958538 6:159200996-159201018 ACATATCACAAAATATCCCAAGG - Intronic
1018486650 6:164247145-164247167 ACTTAGCAGAAAATGGCCGAGGG + Intergenic
1021861624 7:24911589-24911611 ACTTAACTAAAAATAACCCTGGG + Intronic
1022201373 7:28120857-28120879 ACTTACCAGAACTAAACCCTAGG + Intronic
1023572240 7:41584145-41584167 AAGTACCAGAAAATAACACTGGG - Intergenic
1024805554 7:53135465-53135487 TAGTACCAGAAAAGAACCCATGG + Intergenic
1025837630 7:65109629-65109651 TAGTACCAGAAAAGAACCCATGG - Intergenic
1025885443 7:65586369-65586391 TAGTACCAGAAAAGAACCCATGG + Intergenic
1028184570 7:87767939-87767961 ACTACCAACAAAATAACCCAAGG + Intronic
1028338848 7:89693214-89693236 ATTTATCAGAAAATTTCCCATGG + Intergenic
1029874260 7:103732281-103732303 GCTTTCCAGAAACTAGCCCATGG - Intronic
1031012816 7:116541340-116541362 ACTAACCTGACAATAACCAAAGG - Intronic
1034105400 7:148485410-148485432 AGTGATCAGAAAATAACCTAAGG - Intergenic
1034388262 7:150759915-150759937 ACATACTTGAAAATAACCCTTGG + Intergenic
1037080958 8:14785695-14785717 ACGTATCAGAAAATAACAAATGG - Intronic
1038371586 8:26998365-26998387 ACTTTCCAGAAGAAAACCCCAGG - Intergenic
1039976253 8:42367885-42367907 ATTTCACAGAAAATCACCCAAGG - Intronic
1040629563 8:49194932-49194954 ATTTACCACAAAATAAAGCATGG - Intergenic
1041993669 8:64026556-64026578 ACCTGCAGGAAAATAACCCAGGG - Intergenic
1042927583 8:73982136-73982158 ACATACCAGAAAAACACCCGTGG + Exonic
1046443901 8:114290009-114290031 ACATACCTCAAAATAACACATGG - Intergenic
1047418821 8:124689129-124689151 TGTTACCAGAAAATAACTCAAGG - Intronic
1048994553 8:139785905-139785927 ACTAATAAGAAAATAACTCAAGG + Intronic
1050090003 9:2008805-2008827 TCTTACCAGAAAATTATCCTAGG + Intergenic
1053093510 9:35302816-35302838 ACTTCCAAGAAAAATACCCAAGG + Intronic
1053698718 9:40665209-40665231 TAGTACCAGAAAAGAACCCATGG + Intergenic
1053944723 9:43295442-43295464 TAGTACCAGAAAAGAACCCATGG + Intergenic
1054310007 9:63464610-63464632 TAGTACCAGAAAAGAACCCATGG + Intergenic
1055654520 9:78439593-78439615 ACTGACCAGAAGAAAACGCAGGG + Intergenic
1056545497 9:87609728-87609750 ACTTGTCAGAATATAACCCCAGG + Intronic
1059018772 9:110551011-110551033 ACTTACCAGAAAATATACCCTGG - Intronic
1203581456 Un_KI270746v1:9671-9693 TAGTACCAGAAAAGAACCCATGG - Intergenic
1203587858 Un_KI270747v1:24020-24042 TAGTACCAGAAAAGAACCCATGG + Intergenic
1190149801 X:47936039-47936061 ACTAACAAAAAAATAACACACGG + Intronic
1193287692 X:79732074-79732096 AAGTACCAGAAACTCACCCAAGG - Intergenic
1193462088 X:81803235-81803257 ACTTACTATTAATTAACCCAAGG + Intergenic
1193785907 X:85759818-85759840 ATTTACCTGAAAATAATTCAGGG - Intergenic
1194166726 X:90524834-90524856 ACCCACCAGAAAAAAACCCTAGG + Intergenic
1197006041 X:121499549-121499571 ACTTACCAGAAAAGACCCTGAGG + Intergenic
1197812132 X:130454417-130454439 ACCCACCAGAAAATAACCCTGGG - Intergenic
1198139942 X:133792479-133792501 CCTTATCAGAAAAGGACCCAAGG - Intronic
1198623128 X:138535820-138535842 AATTACTAGAAGAAAACCCAGGG + Intergenic
1198883084 X:141302744-141302766 AATCACTAGACAATAACCCAGGG - Intergenic
1199242360 X:145562360-145562382 AATTCCCAGAAAAAAACACAGGG - Intergenic
1199419712 X:147630815-147630837 GTTCACCAGAAAATAAGCCAAGG + Intergenic
1200512994 Y:4102615-4102637 ACCCACCAGAAAAAAACCCTAGG + Intergenic
1200767436 Y:7092225-7092247 ACAAACCAGAAAACACCCCAAGG - Intergenic
1201620918 Y:15956692-15956714 ACTTAGCAGCAAAGAACTCATGG - Intergenic
1202132275 Y:21624017-21624039 ATTTACCAAAATATAACCTAGGG + Intergenic