ID: 965491752

View in Genome Browser
Species Human (GRCh38)
Location 3:169345810-169345832
Sequence CGTTATGTAAAATCACTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965491752_965491754 2 Left 965491752 3:169345810-169345832 CCTTGAAGTGATTTTACATAACG 0: 1
1: 0
2: 1
3: 13
4: 105
Right 965491754 3:169345835-169345857 ATGGCACGATAAAGTAACCAAGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965491752 Original CRISPR CGTTATGTAAAATCACTTCA AGG (reversed) Intronic
905826656 1:41030687-41030709 CGTTACCTAAAATAATTTCATGG + Intronic
908155430 1:61347923-61347945 AGTTATTTAATCTCACTTCAAGG + Intronic
908369510 1:63467855-63467877 CAGTATGTAAGATTACTTCAGGG - Intronic
909887214 1:80957137-80957159 TTTTATGTAAAATAATTTCAGGG + Intergenic
911798308 1:102101745-102101767 CATTATGTAATTTCACTTTAAGG - Intergenic
913590459 1:120319850-120319872 CATTATGAAAACTCACTTCATGG + Intergenic
913617725 1:120578513-120578535 CATTATGAAAACTCACTTCATGG - Intergenic
914572548 1:148932459-148932481 CATTATGAAAACTCACTTCATGG + Intronic
914600293 1:149197803-149197825 CATTATGAAAACTCACTTCATGG - Intergenic
914940615 1:152019868-152019890 CTCTACGGAAAATCACTTCATGG + Intergenic
915036484 1:152931065-152931087 AGTTATCTAAAATCATATCATGG - Intergenic
916883531 1:169045474-169045496 CTTTTAGTAAATTCACTTCAGGG + Intergenic
917273521 1:173304947-173304969 CATTTTGTAAAATCACCACAGGG + Intergenic
918690692 1:187475530-187475552 CTTTTTGTAAAACAACTTCAGGG - Intergenic
919413045 1:197270820-197270842 CCTTATGCATTATCACTTCATGG - Intronic
920759540 1:208769127-208769149 GGCTATGTAAAATCATATCAAGG + Intergenic
922270201 1:224025901-224025923 CGTAATGAAAAAGCTCTTCACGG + Intergenic
922329324 1:224560209-224560231 TATTATGTAAAACCACTTCTAGG + Intronic
922329654 1:224563060-224563082 TATTATGTAAAACCACTTCTAGG - Intronic
923768663 1:236917360-236917382 AGTGATGTAATATCACTTGAAGG + Intergenic
1062865199 10:846639-846661 CGTAATAGAAAATCAATTCAAGG + Intronic
1068109967 10:52668847-52668869 CAATATGCAAAATCACATCATGG - Intergenic
1068145612 10:53066715-53066737 AATTATGTAAAATGACTTCCCGG + Intergenic
1068329327 10:55540643-55540665 TGTTATGTAATATCAATTAAAGG + Intronic
1074291937 10:112144185-112144207 CATTATGTAAAATTATTTCCTGG + Intergenic
1077952472 11:6975318-6975340 TGCAATGTAAAATCACATCATGG + Intronic
1080474667 11:32578973-32578995 TCTTATGTAAAATAAATTCATGG + Intergenic
1082633935 11:55573753-55573775 CTTTTTGTAAAATGACTTTATGG + Intergenic
1085707772 11:78801965-78801987 CCTTAGGTAAAATTACTTTATGG - Intronic
1088640387 11:111867246-111867268 TGTTATGTAAAGCCACTGCAAGG - Intronic
1090304966 11:125683470-125683492 CCTTATTTAAAATAGCTTCAGGG + Intergenic
1090861531 11:130657448-130657470 AGTTATCTAATATCACTTGAAGG + Intergenic
1091818063 12:3454445-3454467 CGTGATGTAAAAGCACTCTAGGG + Intronic
1100134088 12:91533862-91533884 AGTTGTGTAATATCACTTGAAGG - Intergenic
1100626744 12:96342586-96342608 TGTTTTGTACAATCACTTCATGG - Intronic
1100688284 12:97010366-97010388 CTTTATGAAAAATCACCCCAAGG - Intergenic
1111781558 13:92732962-92732984 GGTTAAGTAAAATCAGTTCCCGG - Intronic
1111911516 13:94317569-94317591 CTTTATGCAAAATGTCTTCAAGG + Intronic
1112296810 13:98195088-98195110 TATTATGTAAAATCACTTTGTGG + Intronic
1113730955 13:112641174-112641196 TGTAATTTAAAATTACTTCATGG + Intergenic
1116709779 14:48353203-48353225 CCCTATTTAAAATCACTTAATGG + Intergenic
1117818060 14:59618744-59618766 AGTTATGTAAAATTAGTTTAGGG + Intronic
1120006823 14:79367540-79367562 TGTTCTGTAACATCACATCAGGG + Intronic
1122761314 14:104030070-104030092 ATTTATATAAAAACACTTCAGGG + Intronic
1127746640 15:61983216-61983238 CGTAAAGTAAAATTACATCAGGG + Intronic
1129944138 15:79524561-79524583 AGCTATGCAAAATAACTTCAGGG + Intergenic
1134142683 16:11735275-11735297 CTTTATGTAGAATCACTGAATGG - Intronic
1138329323 16:56200855-56200877 GGTAATGAAAAATCATTTCAAGG - Intronic
1140720400 16:77766340-77766362 TGTTATGTAACATCACGGCAAGG + Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1149012250 17:51869527-51869549 CTTCATGTGAAATCAGTTCAAGG - Intronic
1156708170 18:39909188-39909210 AGTTATCTAATATCCCTTCAAGG - Intergenic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1158356344 18:56623907-56623929 AGTTATGTAAAATGACTTACAGG - Intronic
1159577574 18:70198461-70198483 CATTATTAAAAATCACTTAATGG + Intronic
1166780455 19:45339981-45340003 TGTTATATAAAATAACTTTAGGG + Intronic
928298939 2:30108952-30108974 CTTTATGTAAAAACACCTAAAGG + Intergenic
929067399 2:37992553-37992575 AGTTATCTGAAATCTCTTCAAGG + Intronic
933062178 2:77751872-77751894 AGTGATGTAATATCACTTGAAGG - Intergenic
935511488 2:103981441-103981463 TATTATTTTAAATCACTTCAAGG - Intergenic
939292791 2:140217319-140217341 CGATATGAAAAATCACCTCAGGG - Intergenic
939906752 2:147925694-147925716 CGTTATATAATATCCCTTTAAGG - Intronic
940336148 2:152529657-152529679 CGTAATGTAAATTCACTTCTAGG - Intronic
941787541 2:169514902-169514924 CTTTATGTGAAATCACATTATGG - Exonic
942381928 2:175400661-175400683 CATTATTTACAATAACTTCAGGG + Intergenic
943405673 2:187480773-187480795 CATTATTTAAAATCTCTTTAAGG + Intronic
1173304269 20:41833043-41833065 TTTTATGTAAAAGCAGTTCAGGG + Intergenic
1175940443 20:62535310-62535332 GGTTATTAGAAATCACTTCAGGG + Intergenic
1177923953 21:27190211-27190233 GGTTATGTGAACCCACTTCATGG + Intergenic
1177951703 21:27546195-27546217 TGTTGTGTAAATTCACTTTATGG - Intergenic
1178718404 21:34987489-34987511 GGCTTTGTAAAATCACTTAAAGG + Intronic
1184812529 22:46846205-46846227 CATTATTTAAAACCACATCATGG - Intronic
949134762 3:550895-550917 CGTAATGTAAAATCGATTCACGG + Intergenic
951756779 3:26099370-26099392 CTTTATGTGAATTAACTTCAGGG + Intergenic
953240991 3:41149379-41149401 CGTTATTTTAAATCCCTTCAGGG - Intergenic
959407167 3:105974577-105974599 CCTTATGTAAAATCACAACATGG - Intergenic
965491752 3:169345810-169345832 CGTTATGTAAAATCACTTCAAGG - Intronic
966246505 3:177813810-177813832 CATTGTGTAAAATCAAATCAGGG + Intergenic
968159098 3:196410518-196410540 CTCTGTTTAAAATCACTTCATGG + Intronic
970617729 4:17783057-17783079 CATTTTGGAAAATCACATCAAGG + Intergenic
972766240 4:42153877-42153899 CATTATGCAAAAGCATTTCATGG + Intergenic
979806401 4:124977461-124977483 CGTGGAGTAAAATCAGTTCATGG + Intergenic
980641091 4:135580920-135580942 TGTTATGAAAAATCAATTAAGGG + Intergenic
982664501 4:158244923-158244945 GGTTATTTAAAATCACTTCAGGG - Intronic
986024388 5:3836858-3836880 CATTATGTTCAATCCCTTCAAGG - Intergenic
988340858 5:29969253-29969275 ATTTATGTAAACTCATTTCATGG - Intergenic
988349557 5:30084618-30084640 GTTTATGTAAACTCTCTTCATGG - Intergenic
988465674 5:31489332-31489354 TTTTAAGTAAAATCACTTCTTGG + Intronic
993119452 5:83756681-83756703 CTTTTTGAAAAATCACTTCCTGG - Intergenic
993616019 5:90113477-90113499 TGTTAAGAAAAATCCCTTCACGG + Intergenic
995932970 5:117472786-117472808 AGTTATGTAAAATTACTTATTGG + Intergenic
996429146 5:123351724-123351746 CGTTATGTAAAATTACTTTCAGG - Intronic
1002942230 6:1727723-1727745 TGTTCTGTCAAATCACTTCTTGG + Intronic
1004870506 6:19899490-19899512 CTTTAAGTAAAATCACATAAAGG + Intergenic
1004909634 6:20270572-20270594 AGGTATGTAAAATCATTGCAAGG - Intergenic
1005652960 6:27901813-27901835 TGTTATTCAAAATAACTTCACGG + Intergenic
1009427473 6:63530195-63530217 TGTTAAGTAAATTAACTTCATGG - Intronic
1014990413 6:128068164-128068186 CTTTCTGTAATATCATTTCAAGG - Intronic
1017441421 6:154467572-154467594 CCTTGTGCAAAATCACTTCAAGG - Intronic
1027699130 7:81447963-81447985 CTTTATATATCATCACTTCATGG - Intergenic
1029842304 7:103378569-103378591 CCATATGCAAAATCACTTCATGG + Intronic
1030686810 7:112495470-112495492 CGATATTGAAAATCACTTTAGGG - Intergenic
1035541289 8:440482-440504 CGTAATGAAAAAGCTCTTCACGG - Intronic
1035909733 8:3553188-3553210 TGCAATGTAATATCACTTCATGG + Intronic
1040724337 8:50363488-50363510 TGTTGGGGAAAATCACTTCAGGG + Intronic
1042933754 8:74038124-74038146 CAATGTGTAAAATCACATCAGGG + Intergenic
1042985709 8:74580687-74580709 CCCTATGTATAACCACTTCAAGG - Intergenic
1044765459 8:95567980-95568002 CGTGAGGTAATATCTCTTCATGG + Intergenic
1044878637 8:96699545-96699567 CAATGTGTATAATCACTTCAGGG - Intronic
1045961669 8:107975996-107976018 AGTGATGTAAAGCCACTTCAGGG + Intronic
1046508060 8:115161621-115161643 GATAATGCAAAATCACTTCACGG + Intergenic
1048004827 8:130410826-130410848 AGTGATGAAAAATCACTTCTGGG + Intronic
1055190590 9:73517033-73517055 CATTATGTAAGACCACTTGATGG + Intergenic
1057454805 9:95198548-95198570 CGTTTTGGAAAATCACCTCCTGG + Intronic
1057675098 9:97131698-97131720 GGTTTTGTAAAACCACCTCAGGG + Intergenic
1187351440 X:18521674-18521696 CGTTATGAGAAATTACTTAATGG - Intronic
1190788575 X:53678108-53678130 CTTTCTGTAAAATCACATTATGG + Intronic
1192371396 X:70516280-70516302 CCTTATATAAAATTAATTCAAGG - Intergenic
1194462512 X:94189860-94189882 CGTTGTGTAAAATCACCTTCTGG + Intergenic
1196277999 X:113791309-113791331 CATTATTTAAAATGACTTTAAGG + Intergenic