ID: 965492857

View in Genome Browser
Species Human (GRCh38)
Location 3:169361217-169361239
Sequence GTGCACAGGAGGAGGACTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965492857 Original CRISPR GTGCACAGGAGGAGGACTAG GGG (reversed) Intronic
901073865 1:6539954-6539976 GAGGACAAGAGGAGGACAAGAGG + Intronic
902978879 1:20109208-20109230 GTCCCCTTGAGGAGGACTAGGGG - Intergenic
903961263 1:27059187-27059209 TTGCAGAGGAGGAGGAGGAGCGG + Intergenic
905890651 1:41516556-41516578 GTGCTCAGGAGGTGGAAAAGCGG - Intronic
907391842 1:54163264-54163286 GTGAACAGTAGGAGGCCCAGGGG - Intronic
909561824 1:77016157-77016179 GAGGACAGGAGGAGGAGGAGGGG - Intronic
910189151 1:84576997-84577019 GTGCACAGGAAGAAGACAGGAGG + Intergenic
910240212 1:85078465-85078487 GTGCAGAGGAGGAGGCCTTCAGG - Intronic
910636013 1:89408742-89408764 GTGGAGAGGAGGAGGAGAAGGGG - Intergenic
912602650 1:110953158-110953180 GAGTAGAGGAGGAGGACAAGAGG - Intronic
912699221 1:111864053-111864075 GAGCAGAGGAGGAGGAGCAGGGG + Intronic
913521921 1:119652716-119652738 CTGCAGATGAGGAGGACTAATGG - Intergenic
913542854 1:119838567-119838589 GTGTACAGGAGGAGTACAGGAGG - Intergenic
916542838 1:165773655-165773677 GTGCACAGGTGTAGAGCTAGGGG + Intronic
919603943 1:199657074-199657096 GTGGCGGGGAGGAGGACTAGGGG - Intergenic
924263027 1:242251580-242251602 CTGCACAGGGGTAGGACCAGTGG + Intronic
1070560790 10:77565148-77565170 GTGCAAGGCAGGAGGACTAGGGG - Intronic
1071731782 10:88255475-88255497 GAGCAAGGGAGGAGGAGTAGGGG + Intergenic
1071829187 10:89354984-89355006 GGCCACAGGAGGAGGATTGGTGG + Intronic
1072501499 10:96022843-96022865 GTGCACAGCAGGAGGCCCTGAGG + Intronic
1074708508 10:116157655-116157677 GTGCACAGGAGGAGGGGAGGAGG - Intronic
1075455450 10:122582065-122582087 GTGCTCAGGACGAGCACTGGAGG + Intronic
1075457573 10:122594768-122594790 GTGCTCAGGACGAGCACTGGAGG + Intronic
1075458652 10:122601262-122601284 GTGCTCAGGATGAGCACTGGAGG + Intronic
1075459283 10:122605321-122605343 GTGCTCAGGATGAGCACTGGAGG + Intronic
1075459915 10:122609380-122609402 GTGCTCAGGATGAGCACTGGAGG + Intronic
1075460547 10:122613439-122613461 GTGCTCAGGATGAGCACTGGAGG + Intronic
1075477700 10:122750500-122750522 GTGAAGTGGAAGAGGACTAGAGG - Intergenic
1076437003 10:130453430-130453452 GTGCAGACGAGGAGCACTGGAGG - Intergenic
1077106280 11:843881-843903 TTGCAGAGGAGGAGGACGAAGGG + Intronic
1077631989 11:3817185-3817207 GTGCAGAGGAGAAGGATCAGAGG - Intronic
1079614364 11:22472474-22472496 AGGCACTGGTGGAGGACTAGAGG - Intergenic
1080729847 11:34938141-34938163 GTGAACAGAAGGACGACTAGAGG + Intronic
1082264951 11:50108294-50108316 GTGGGCAGAAGGAGGACTGGAGG - Intergenic
1085034609 11:73292586-73292608 GGGCAGAGGAGGAGGGGTAGGGG - Intronic
1085775939 11:79366481-79366503 GTGCACAGGCTGTGGATTAGGGG + Intronic
1086299522 11:85411141-85411163 GTACAAAGGAGGAGGAATAGTGG + Intronic
1088609434 11:111563128-111563150 TTTCACAGGAGTAGGACTTGTGG + Intergenic
1089158277 11:116418492-116418514 GTGCATGGGAGGAGGGCTGGGGG + Intergenic
1089380669 11:118028900-118028922 GAGGACAGGAGGAGGAGGAGGGG + Intergenic
1089765360 11:120759303-120759325 TTCCACAGTAGGAGGTCTAGAGG + Intronic
1091838532 12:3602824-3602846 GTGCACAGGATGAGGACTCCGGG - Intergenic
1094363145 12:29651631-29651653 GTTCACAGGAGGAGGGCTGTGGG - Intronic
1095964435 12:47857452-47857474 GTCCAGAGGAGAAGCACTAGTGG - Intronic
1096563044 12:52450764-52450786 GTGCAAAGGAGAAGGAGTTGGGG - Intronic
1101603090 12:106227319-106227341 GTGGGCAGGAGGAGGCCTAAGGG - Intergenic
1101632881 12:106512767-106512789 GTGCACAGGGTTAGGTCTAGTGG + Intronic
1103893019 12:124254130-124254152 ACTCACAGGAGGAGGACAAGAGG - Intronic
1104283448 12:127400006-127400028 GTGCACAGTAGAAGGGCTATTGG + Intergenic
1105506020 13:21010375-21010397 GTGACCAGGTGGAGGACTGGGGG - Intronic
1105925578 13:25004634-25004656 GAGGACAGGAGGAGAACCAGAGG - Intergenic
1106039124 13:26073026-26073048 GAGGACAGGAGGAGAACCAGAGG + Intergenic
1106136695 13:26978878-26978900 GTGCACAGGAAAAAGACTCGGGG + Intergenic
1113835393 13:113325553-113325575 GTGCACAGGACGGGCACCAGTGG - Exonic
1114209311 14:20601799-20601821 GTACACTGGTGGGGGACTAGTGG - Intronic
1117866442 14:60154202-60154224 GTGGTCAGGAAGAGGACTAGTGG + Intronic
1118614535 14:67566256-67566278 GGGCACATCAGGAAGACTAGGGG + Intronic
1118761302 14:68881819-68881841 TTGCTCAGGAGGAGGAGGAGAGG + Intronic
1119700900 14:76753896-76753918 GTGCACTGTAGGACGGCTAGTGG - Intergenic
1119958909 14:78832592-78832614 GGGTAAAGGAGGAGGACAAGAGG + Intronic
1122018342 14:98816382-98816404 GTGCACAGGAGAATGGCCAGAGG + Intergenic
1122347071 14:101067346-101067368 GTCCCGAGGAGGAGGACAAGGGG - Intergenic
1127278319 15:57467290-57467312 GTGCTTAGGAGGAGGACTGCTGG + Intronic
1128697583 15:69780139-69780161 GTGCACTGTAGGATGCCTAGCGG - Intergenic
1129695666 15:77739451-77739473 GGGCACAGAAGTAGGACCAGGGG - Intronic
1130430992 15:83846601-83846623 GTGCACATCAGGAGCACTTGGGG + Intronic
1131278842 15:91005032-91005054 GTGCGCAGGTGGAGGGCTGGGGG - Intronic
1132005203 15:98220295-98220317 GTGGACGGGAGGAAGACTAATGG - Intergenic
1132935998 16:2481570-2481592 GGACACAGGAGGAGAACCAGAGG - Intronic
1134247042 16:12547734-12547756 CTTCACAGGAGGAGGCTTAGAGG - Intronic
1136618863 16:31414789-31414811 ATGCAGTGGAGGAGGACTTGTGG + Intronic
1139145774 16:64323325-64323347 GTGCACAGGGGAAGGACCATGGG + Intergenic
1139212834 16:65097492-65097514 GTGCACTGCAGGACGTCTAGCGG + Intronic
1139424770 16:66872867-66872889 GTGCACACGGGGAGGAAAAGGGG + Intronic
1139547640 16:67657154-67657176 GTGCACTGGAGGTGGAAGAGAGG + Intronic
1140880818 16:79196648-79196670 GTGTACAGGATGAGAACTGGAGG - Intronic
1141946052 16:87310827-87310849 GTGCAGAGGGGGAGGAAGAGAGG + Intronic
1142177082 16:88650342-88650364 ATGCACAGGAGGGTGACTGGGGG + Intronic
1142302598 16:89267204-89267226 GTGCAAAGGCAGAGGACGAGGGG + Intergenic
1142340205 16:89517021-89517043 GGGCTGAGGAGGAGGACGAGGGG + Intronic
1143778181 17:9212980-9213002 GGGCACAGGAGGCAGACCAGAGG + Intronic
1147846851 17:43410548-43410570 GTGCACTGAAGGCTGACTAGGGG + Intergenic
1149008279 17:51828348-51828370 GTGCACAGGAGCAGGAAGAATGG - Intronic
1149488619 17:57065393-57065415 TTCCACAGGAGGAAAACTAGGGG + Intergenic
1149573029 17:57688352-57688374 CTGGAGAGGAGGAGGCCTAGTGG - Intergenic
1150811874 17:68363184-68363206 GAGCAAAGGAGGAGGACTATTGG + Intronic
1151368794 17:73634169-73634191 GGGCACAGGAGGAGGACACAGGG - Intronic
1151474517 17:74338175-74338197 GTGGACACGGGGAGGACCAGTGG - Intronic
1151670427 17:75569094-75569116 GTGCCCAGGGCGAGGACGAGTGG + Exonic
1152163642 17:78686431-78686453 ATTCACAGGAGGAGAACCAGGGG - Intronic
1152267630 17:79305508-79305530 GTCCAGAGGAGGCGGACAAGGGG - Intronic
1152450586 17:80376801-80376823 CTGCTCAGCAGGAGGCCTAGAGG - Intronic
1152517296 17:80833173-80833195 GTGCCCAGGAGGTGGGCTGGAGG - Intronic
1152979565 18:263458-263480 GTGTACAGCAGGAGGAGGAGAGG - Intronic
1153366356 18:4261343-4261365 GAGCAGAGGAGCAGGGCTAGAGG - Intronic
1154070478 18:11148480-11148502 GGGCACTTGAGGAGGACGAGGGG - Intronic
1156457928 18:37305049-37305071 GGGAACAGGAGGAGGAGAAGGGG + Intronic
1156967413 18:43111657-43111679 ATGTATAGGATGAGGACTAGAGG - Intronic
1157489536 18:48113151-48113173 GTGGACAGGAGCAGGACAAAGGG + Intronic
1157522189 18:48352887-48352909 GTGCAGAAGTGGGGGACTAGGGG - Intronic
1159689441 18:71467843-71467865 GCACACAGCAGGAGGACTACAGG - Intergenic
1160554129 18:79715052-79715074 GTGGGCAGGAGGAGGGCGAGCGG + Exonic
1161286065 19:3468901-3468923 GAGGACAGGAGGGGGACAAGGGG + Intronic
1163061197 19:14763602-14763624 GAGCACAGGAGGAGGAGGAGAGG - Intronic
1163592881 19:18204237-18204259 GCGGACAGGAGGCGGACGAGAGG - Intergenic
1164292437 19:23880311-23880333 GAGCAGAGGAGGAGGAAAAGAGG + Intergenic
1168172571 19:54598345-54598367 ATGTACAGGAGGAAGACTTGAGG - Intronic
925008841 2:467305-467327 GTGAACAGGAGGAGGCTTTGGGG - Intergenic
925208357 2:2026364-2026386 GTGCCCAGGAGGGAGACTGGAGG + Intronic
925348786 2:3187634-3187656 GTGCACAGGTGGATGAGGAGTGG - Intergenic
925943374 2:8839797-8839819 GAGGACAGAAGGAGGACTAGGGG - Intergenic
926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG + Intergenic
929441443 2:41968337-41968359 ATGCCCAGGAGGAGGACTCCAGG - Intergenic
930762075 2:55049185-55049207 GAGCACAGGAGGAGGGGGAGGGG + Intronic
931577863 2:63738418-63738440 GTGCACAGGAGAAGGAGTGGGGG - Intronic
934037130 2:88097533-88097555 GTGCTCAGGGGGAGGATGAGGGG + Intronic
934087579 2:88523013-88523035 ATGCACAAGAGGATGACTAGTGG - Intergenic
937007299 2:118528763-118528785 GTGCACAGCAGACGGACTTGTGG + Intergenic
938221941 2:129576572-129576594 TTGCAGAGGAGGAGGAGGAGGGG - Intergenic
938337379 2:130511704-130511726 GAGCACACGGGGAGGACTCGGGG - Intergenic
938352459 2:130609031-130609053 GAGCACACGGGGAGGACTCGGGG + Intergenic
939982099 2:148794401-148794423 ATGCAGAGGTGGAGGACAAGTGG + Intergenic
941848615 2:170157121-170157143 GGGCAAAGGAGGAGGAAGAGAGG - Intergenic
942557302 2:177185156-177185178 GTGGACAGGAGAAGGAATATAGG - Intergenic
944352657 2:198746768-198746790 GTACACAGGTGTAGGACTGGGGG + Intergenic
946384437 2:219373956-219373978 TTTCCCAGGTGGAGGACTAGGGG + Exonic
948099089 2:235359461-235359483 GTGCCCAGGAGGAGGGCTGCTGG - Intergenic
948737147 2:240016604-240016626 GTGCACAGGAGGAAGCAGAGGGG - Intronic
1168765109 20:376878-376900 TTTCACAGGAGGAGAACTGGTGG - Intronic
1169135613 20:3195339-3195361 GTCCACAGGAGGAGGAGGAGAGG - Exonic
1172627623 20:36357188-36357210 GTGCTCTGGGGGAGGACGAGAGG - Intronic
1172656704 20:36542195-36542217 GGGGGCAGGACGAGGACTAGTGG + Intronic
1175602618 20:60287363-60287385 GTTAACGGGAGGAGGATTAGAGG + Intergenic
1178342955 21:31801554-31801576 ATACACAGGAGGAGGTCTGGAGG + Intergenic
1179721657 21:43319686-43319708 GTGCAGAGGAGGATGACGACAGG - Intergenic
1180901461 22:19376423-19376445 GTGCTTAGGAGGAGGTCCAGTGG - Intronic
1184652584 22:45925906-45925928 GGCCACAGCAGGAGCACTAGAGG - Intronic
1184841283 22:47053621-47053643 GTGCACAGCAGGAGGTTGAGAGG + Intronic
950053578 3:10009311-10009333 TTGCACAGGAGGAGGTCTGGGGG - Intronic
950305225 3:11911599-11911621 TTGCACAGGAGGAGGTCTGGGGG - Intergenic
950415384 3:12866317-12866339 TTGCACAGGAGGAGGTCTGGGGG - Intronic
954796411 3:53163419-53163441 GTGCACATGGAGAGGGCTAGAGG + Intronic
955939541 3:64134521-64134543 GTGCACTGTAGGAGGTTTAGCGG + Intronic
961772184 3:129258118-129258140 GGCCACAGGAGGAGGCCTGGTGG + Intronic
961810527 3:129519224-129519246 GTGCACAGGAGAAGGGATGGAGG - Intronic
965492857 3:169361217-169361239 GTGCACAGGAGGAGGACTAGGGG - Intronic
968815743 4:2820775-2820797 GTGCACAGTAGGAGGGCATGGGG + Intronic
969652147 4:8474230-8474252 GTGCTCAGGAGGAGCCCCAGGGG - Intronic
970245255 4:14054798-14054820 GTGCAAAGGTGGAGTAATAGTGG - Intergenic
972642691 4:40940088-40940110 GTGCACAGGATGAGGAGAACAGG + Intronic
972700264 4:41487397-41487419 GAGCAGAGGAGGAGGAACAGAGG + Intronic
973536205 4:51884864-51884886 GGGGACAGGAAGGGGACTAGAGG + Intronic
975991493 4:80263911-80263933 GTTCACAGGAGTAGGGCTCGAGG + Intergenic
976087228 4:81418794-81418816 GTACACAGCTGGAGGACTGGGGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977183849 4:93911622-93911644 GTCCAGAGCAGGAGGAATAGAGG - Intergenic
980086154 4:128392201-128392223 GTGCTCAGGTGGAGGGGTAGGGG + Intergenic
981178695 4:141714077-141714099 GGGGACAGGAGGAGGAGGAGAGG - Intronic
984844974 4:184101060-184101082 GGACACAGGAGGAGGCCGAGGGG + Intronic
985026458 4:185743978-185744000 GGGGACAGGAGGAGGAGGAGGGG - Intronic
985539268 5:480274-480296 GTGCACAGGAGGAAGGGCAGGGG + Intronic
987839945 5:23210739-23210761 TTGCATAGTAGGATGACTAGAGG + Intergenic
988655901 5:33211459-33211481 GTGCACTGGAGGAGGTCCTGGGG - Intergenic
991408151 5:66321632-66321654 TTGAACAGGAGGAGAACCAGTGG + Intergenic
992760941 5:79950554-79950576 GTGAACAGGAGAGGGGCTAGAGG - Intergenic
995717216 5:115092147-115092169 GAGCACGGGAGATGGACTAGAGG + Intergenic
996207506 5:120759512-120759534 GGGCTCAGGAGGAGGCATAGAGG + Intergenic
997059323 5:130481838-130481860 GAGCTCAGGAGGAGGACTGAAGG - Intergenic
997303096 5:132820618-132820640 GAGCACAGGGGTAGGAGTAGGGG - Intergenic
999001561 5:147929343-147929365 GAGCACAGAAGGAAGATTAGAGG + Intergenic
999267889 5:150278725-150278747 GTGCAAAGGAGGAGGGGTGGGGG + Intronic
999824642 5:155262441-155262463 GTGCACAGGTGGAGGTCCTGTGG + Intergenic
1000927772 5:167214730-167214752 GAGCAGAGGAGGAAGACTAAGGG + Intergenic
1001557683 5:172647584-172647606 GTGCTCAGGACGAGGACAAGGGG - Intronic
1001780457 5:174364483-174364505 ATGAGCAGGAGGAGGAGTAGGGG - Intergenic
1001796322 5:174505204-174505226 GTGGACGGGAGGATGAGTAGTGG - Intergenic
1002549000 5:179973165-179973187 TTGCACAGAAGCTGGACTAGCGG - Intronic
1002575056 5:180169839-180169861 CTGCACAGGGGGAGGGCGAGGGG - Intronic
1005454440 6:26005688-26005710 AAGCACTGGAGGAAGACTAGAGG + Intergenic
1005910272 6:30303387-30303409 GTGCACTGGAGGAGGAGTGAAGG - Intergenic
1006667181 6:35703785-35703807 GTGCACAGCAGGAGGCTTGGTGG + Intronic
1007392118 6:41555523-41555545 GGGCACAGGAGGGGCTCTAGAGG - Intronic
1008459189 6:51748270-51748292 GTTCACAAGAGGAGCACTTGTGG + Exonic
1011662819 6:89608963-89608985 GGGCACAGGAGGTGCTCTAGGGG - Intronic
1011716376 6:90109394-90109416 GAGCAGAGGAGGAGGAGCAGAGG - Intronic
1018565920 6:165153076-165153098 CTGCAGAGGAGGAGGCCTGGTGG + Intergenic
1019180586 6:170185323-170185345 GAGCACAGGAGGAGGATGGGGGG - Intergenic
1019341222 7:510041-510063 GTGCATGGCAGGAGGAGTAGGGG - Intronic
1019756867 7:2777077-2777099 CTACACAGGTGCAGGACTAGGGG - Intronic
1020398396 7:7745204-7745226 GTGAAGAGGAGGAGGAAGAGGGG + Intronic
1020661019 7:10982720-10982742 GTTAACAGCAGGAGGACTTGTGG - Exonic
1022040185 7:26573738-26573760 ATGCACAGTAGGAGGAGGAGAGG - Intergenic
1024222387 7:47298834-47298856 GTGCACAGGATGAGGGCACGGGG + Intronic
1025285132 7:57654475-57654497 GTGCAGGGGAGGTGGACTAAGGG - Intergenic
1027784535 7:82564352-82564374 GGGAATGGGAGGAGGACTAGAGG + Intergenic
1027887813 7:83931814-83931836 CTGCACAGGAGGCTGAATAGTGG + Intergenic
1029630906 7:101749551-101749573 GAGCACAGGTGGGGGACCAGGGG - Intergenic
1029914199 7:104189724-104189746 GTACACAGGACAAGGACCAGTGG - Intronic
1030615029 7:111729753-111729775 GAGCTCAGGAGGAGGAGCAGAGG + Intronic
1030815566 7:114032386-114032408 GTGCACAGCAGGAGAACAATCGG - Intronic
1033648260 7:143321433-143321455 CTGAAGAGGATGAGGACTAGTGG - Exonic
1035296171 7:157867926-157867948 GTCCACAAGAGCAGGACTGGGGG + Intronic
1035316783 7:158001538-158001560 GTGCACAGCAGGGGGACCTGAGG + Intronic
1037221512 8:16528196-16528218 GAGCACAGGAGAAAGACTATAGG + Intronic
1038444620 8:27594791-27594813 GGGCACCTGAGCAGGACTAGGGG + Intergenic
1044829683 8:96235184-96235206 GGGCACAAGAGGATAACTAGTGG - Intronic
1049102757 8:140590916-140590938 GCCCACAGGAGGAGGGGTAGGGG - Intronic
1049978305 9:881114-881136 CTGCACAGGAGGAGGAGGTGGGG - Intronic
1051162453 9:14223569-14223591 TTGCACAAGAGGAGAACTTGAGG - Intronic
1056659897 9:88535790-88535812 GTGCAGAGGGGGAGGCCTGGGGG - Intronic
1057284810 9:93743413-93743435 TTGCACAGGTGAAGGATTAGTGG + Intergenic
1057924520 9:99132308-99132330 GTGCATAAAAGGAGGCCTAGTGG + Intronic
1058910808 9:109518380-109518402 CTGCACTGGAGGTGGAGTAGAGG + Intergenic
1059845427 9:118270199-118270221 GTGAAAAAGAGCAGGACTAGGGG - Intergenic
1060099045 9:120821693-120821715 GTTCACAGGAGGTAGAATAGTGG - Intronic
1060452518 9:123756536-123756558 GGGCACAGGAGGATGACTGCTGG - Intronic
1060624790 9:125102063-125102085 GTGCACTGCAGGATGTCTAGCGG + Intronic
1061778835 9:132984208-132984230 GTGAGCAGGAGGAGGACTGGGGG - Intronic
1062360550 9:136185977-136185999 CTGCACAGCAGGAGGGCAAGTGG + Intergenic
1186114317 X:6289382-6289404 GTCCACAGGAAGAGGAATTGCGG - Intergenic
1189469863 X:41305406-41305428 GTGCACAGAAAAAGGACTGGAGG - Intergenic
1192042317 X:67635533-67635555 GGGGACAGGAGGAGGAGCAGAGG + Intronic
1192234471 X:69286989-69287011 GGGCACTGGAGGAGGAGTTGGGG - Intergenic
1193133516 X:77944667-77944689 GGGCACAGGAGGATCACTAGAGG - Intronic
1197782480 X:130171846-130171868 GTGCGCTGGAGGAGGAGGAGGGG + Exonic
1199650799 X:149944861-149944883 GAGCAGAGGAGGAGGAGGAGAGG + Intergenic
1201593209 Y:15637783-15637805 GAGCACAGGAGGAGGCCAATGGG - Intergenic