ID: 965509773

View in Genome Browser
Species Human (GRCh38)
Location 3:169555556-169555578
Sequence CTGTAGGCCTAAAACCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965509771_965509773 11 Left 965509771 3:169555522-169555544 CCAAACAGGGGTCTAACAATGTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 965509773 3:169555556-169555578 CTGTAGGCCTAAAACCATGAAGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965509773 Original CRISPR CTGTAGGCCTAAAACCATGA AGG Intronic
906076028 1:43052721-43052743 CTGTAGACCTCAAACCATAATGG - Intergenic
907588102 1:55639592-55639614 ATGAAGGCATAAAAACATGAAGG - Intergenic
912809162 1:112780789-112780811 CTCTAGGCCTAAATCCAAGAAGG - Intergenic
916243770 1:162666033-162666055 ATGTTGGACAAAAACCATGAAGG + Intronic
917164554 1:172097598-172097620 ATGTAGGACTTAAAGCATGATGG + Intronic
918587978 1:186209715-186209737 CTGCAAGCCTAAAAACATCAAGG + Intergenic
1064338894 10:14469115-14469137 GAGTAGGGCTAAAACCATGAGGG - Intergenic
1064781299 10:18841801-18841823 CTTTAGGGGTAAAACCATGGAGG + Intergenic
1065104240 10:22365100-22365122 CTGTAGGCATAAAATTATTAGGG + Intronic
1065899462 10:30192115-30192137 CAGTTGTCTTAAAACCATGAGGG + Intergenic
1076222829 10:128748300-128748322 CTGTATTCCTAAAACCTGGAAGG + Intergenic
1077691384 11:4345813-4345835 CTGTTGGCCTGAAAGCCTGAGGG + Intergenic
1077703122 11:4459794-4459816 CATCAGGACTAAAACCATGAAGG - Intergenic
1079050364 11:17151019-17151041 ATGTAGTCCTAAAACTATAATGG + Intronic
1080894506 11:36438156-36438178 CTGTAGAGCTAATACCACGATGG + Intronic
1086306553 11:85486333-85486355 CTGTGGGCCTACCACCAGGAAGG - Intronic
1089275493 11:117332933-117332955 CTCCAGGCCTAAAACTGTGAAGG - Intronic
1092808506 12:12250063-12250085 TTTTAGGCCTAAAGTCATGAAGG - Intronic
1093641892 12:21537108-21537130 CTGGAGGCCTGAGACCCTGAAGG + Exonic
1094002204 12:25707400-25707422 CTGCAGGCTTAACACCATGTGGG - Intergenic
1095883324 12:47162582-47162604 CAGGAAGCCTAAAATCATGATGG + Intronic
1096861646 12:54533069-54533091 CTATCTGCCTAAAATCATGAGGG + Intronic
1105901609 13:24759448-24759470 CTGGAGGCATAATACCTTGAGGG - Intergenic
1114157420 14:20120469-20120491 CTCTAGTCCTAGAACCAAGATGG + Intergenic
1118009793 14:61598856-61598878 GTATAGCCCTAAAACCATGCTGG + Intronic
1120101552 14:80450715-80450737 CTGGAGGCCCAACACCATGTGGG - Intergenic
1120338078 14:83184738-83184760 CTGAAGGCGTAAAACCCAGAGGG - Intergenic
1122683611 14:103486765-103486787 CAGTAGGCCTAACACCCAGAAGG - Intronic
1123777686 15:23596948-23596970 CTTCAAGCCTAAAACCCTGAAGG - Intronic
1124347286 15:28931154-28931176 CCGTAGGCCAGAAACCATGCTGG + Intronic
1125721850 15:41849038-41849060 CTGGAGGGCTCATACCATGAGGG - Intronic
1126892065 15:53217229-53217251 TTGTAAGCATAAAAGCATGAGGG + Intergenic
1131292188 15:91116236-91116258 CTGTTTTCCTAAAACCAGGAGGG + Intronic
1136867133 16:33767558-33767580 CTAAAGGCCGAAAACCAGGATGG - Intergenic
1137343264 16:47630986-47631008 CCGAAGGCCTAAACCCAGGAAGG - Intronic
1138561805 16:57805445-57805467 CTGAAGTCCTAAACCCTTGAGGG + Intronic
1141639497 16:85333171-85333193 CTGTAGGGCTCATACCAGGAGGG + Intergenic
1146375339 17:32290110-32290132 CTGTCCACCTAATACCATGAGGG - Intronic
1147884283 17:43674355-43674377 GCATAGGCCTAAAACCATGGAGG + Intergenic
1152588289 17:81198830-81198852 CTTAAAGCCAAAAACCATGATGG + Intronic
1152846888 17:82606179-82606201 CTGTAGTCCAAAGAGCATGAGGG + Intronic
1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG + Intronic
1165602256 19:37064766-37064788 CTGTAATCCTAAATCCATTAGGG - Intronic
1167877508 19:52426585-52426607 ACGTTGGCCTAAAACAATGAAGG + Intergenic
926327052 2:11794185-11794207 CTAGAGGCCTTAAAGCATGAAGG + Intronic
926459776 2:13114600-13114622 CTGAAGGCCTAAAAACCAGATGG + Intergenic
927872114 2:26630289-26630311 CTGTAGGCCTAAGAGCTTGCTGG - Intronic
928319551 2:30272158-30272180 CTGAAGGCCTAAAACCCAGGAGG - Intronic
932527984 2:72493226-72493248 AAGTAGTCCGAAAACCATGATGG - Intronic
936552404 2:113457566-113457588 CTGTAGACCTAACTTCATGAAGG - Intronic
936573902 2:113637740-113637762 CTGTAGGCCTGAAACCAAACTGG - Intronic
938235248 2:129700575-129700597 CTGTATGCTTAAAATCATTAAGG - Intergenic
939499791 2:142969450-142969472 CTGTAGTCTTAAATCCATGCAGG + Intronic
940439713 2:153700051-153700073 CTTTAGGCCAATAACCTTGATGG + Intergenic
941308573 2:163900918-163900940 CTGTAGGCCAATATCCCTGATGG + Intergenic
942283940 2:174395419-174395441 CTCTAGGCCTAAAGCCCTGGTGG - Intronic
945704733 2:213214790-213214812 CTGTAGGCATATAACAATGTTGG + Intergenic
948499410 2:238380884-238380906 CTGTAGCCATAAAACAAAGATGG + Intronic
1170769045 20:19316408-19316430 GTGTAGGCTGAAAACCATCAGGG + Intronic
1174003717 20:47393571-47393593 CTGTATGCCTAGCACCAGGATGG - Intergenic
1174758408 20:53182339-53182361 CTGAAGCTCTAAAACCATGCTGG - Intronic
1183123274 22:35748999-35749021 CTGTAGGCCTAGGAAAATGAGGG - Intronic
1185426274 22:50773153-50773175 CTGTAGGCCTGAAACCAAACTGG + Intronic
949201265 3:1382418-1382440 ATGTATGCCTAAAAAAATGATGG + Intronic
952914965 3:38229672-38229694 CTGTTGGTCTAAAACCAGGAAGG - Exonic
957693967 3:83609307-83609329 CTGTTGGCCAAAGACCATAAGGG - Intergenic
957764695 3:84607848-84607870 CTGAAGGGCTAAAATCATAAAGG + Intergenic
965509773 3:169555556-169555578 CTGTAGGCCTAAAACCATGAAGG + Intronic
968317026 3:197733715-197733737 CAGTATGCCTATAACAATGACGG + Intronic
969644233 4:8417262-8417284 CTCTAGGCCTTAAACAGTGAAGG - Intronic
977374153 4:96179784-96179806 CTGTAGTCCTAATTCTATGAAGG - Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
980098370 4:128517040-128517062 CAGCAGACCTAAAACCAGGATGG + Intergenic
982334067 4:154214445-154214467 CTGAAGGTCTAACAGCATGAGGG + Intergenic
982637645 4:157916967-157916989 CTTTTGGCCAAAAACCCTGAAGG - Intergenic
987981200 5:25086505-25086527 CTGTAGGCCTAAATTCCTTATGG - Intergenic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
1000866096 5:166516882-166516904 CTGTAGTCATAAAATGATGAAGG - Intergenic
1011622229 6:89253739-89253761 CTGTGGGCCTAAGACCGTCAAGG + Intergenic
1013722635 6:113049339-113049361 CTGCAGGCCTCAAACCAGTAGGG + Intergenic
1015899871 6:138053352-138053374 CTGAAGCCATAAACCCATGAAGG + Intergenic
1020183354 7:5939763-5939785 CTGTAGGCCGAAAAGCACGTCGG + Intronic
1020299558 7:6784995-6785017 CTGTAGGCCGAAAAGCACGTCGG - Intronic
1022276176 7:28857014-28857036 GTGAAGGCCTAAACCCATGTGGG - Intergenic
1026197838 7:68188302-68188324 CTGGAGGCCTAAAAAGGTGAGGG + Intergenic
1027935386 7:84595388-84595410 CTATAGGCCAATAACCCTGACGG + Intergenic
1030347240 7:108448018-108448040 CTGCTGTCCTAAAACCATGAGGG - Intronic
1031947729 7:127858655-127858677 ATGTAGGCCATAAACCATAATGG + Intronic
1032429615 7:131850006-131850028 CTGTAAGACTAAAACAAGGAAGG - Intergenic
1032558718 7:132865351-132865373 CTGGAAACCTAAAACCAGGAAGG + Intronic
1034980238 7:155471160-155471182 CTCTAGGCCTATTGCCATGACGG + Intergenic
1037975627 8:23209143-23209165 CTGCAGGCTTAACACCATGTGGG - Intronic
1040317195 8:46270360-46270382 CTTTGGGGCTAAAACCACGATGG - Intergenic
1043139848 8:76574490-76574512 CTTCAGGGCTGAAACCATGAGGG - Intergenic
1045567619 8:103337718-103337740 AGGAAGGACTAAAACCATGAGGG - Intergenic
1045738883 8:105330291-105330313 CTGTAGGCTTAATATCAGGAAGG + Intronic
1046728223 8:117697248-117697270 CTGTGGGAATAGAACCATGAAGG + Intergenic
1047095721 8:121623366-121623388 CTCTAAGGCTTAAACCATGAAGG + Intronic
1049684504 8:143933917-143933939 CTGCAGCCCTAAAGCCAGGAGGG - Intronic
1049900596 9:159617-159639 CTGTAGACCTAACTTCATGAAGG + Intronic
1053523510 9:38806118-38806140 CTGTTGTCATAAAACTATGAAGG + Intergenic
1053743636 9:41169900-41169922 CTGTAGACCTAACTTCATGAAGG + Intronic
1054195738 9:62030534-62030556 CTGTTGTCATAAAACTATGAAGG + Intergenic
1054348912 9:63999716-63999738 CTGTAGACCTAACTTCATGAAGG + Intergenic
1054483635 9:65695406-65695428 CTGTAGACCTAACTTCATGAAGG - Intronic
1054642670 9:67558155-67558177 CTGTTGTCATAAAACTATGAAGG - Intergenic
1054684707 9:68261358-68261380 CTGTAGACCTAACTTCATGAAGG - Intronic
1057558793 9:96111072-96111094 TTGGAGGCCTAAACCCATAATGG + Intronic
1060557261 9:124514425-124514447 CTGTGGACCTAAAACCCTGATGG + Intergenic
1186206525 X:7206106-7206128 CTGGGGGCCCAAAACGATGAAGG - Intergenic
1188389772 X:29605270-29605292 CTGTAAGTCTAAAGACATGATGG - Intronic
1190638044 X:52455721-52455743 CAGTAGGCCAAAAATCCTGAAGG + Intergenic
1190678614 X:52804729-52804751 CAGTAGGCCAAAAATCCTGAAGG - Intergenic
1193226300 X:78988338-78988360 CTGTAGGCCTGAAAACAGGGTGG + Intergenic
1193236630 X:79114610-79114632 CTGCAGGCCCAACACCATGTGGG + Intergenic
1196846346 X:119899481-119899503 CAGTGGGCCTAAAACGTTGAGGG + Intronic
1198931533 X:141866582-141866604 CTGTGGGCCTATATCCAGGAAGG - Intronic
1200038493 X:153348376-153348398 AAGTAGGCCAAAAATCATGAGGG - Exonic