ID: 965511024

View in Genome Browser
Species Human (GRCh38)
Location 3:169568065-169568087
Sequence GAGGGTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3232
Summary {0: 12, 1: 166, 2: 439, 3: 860, 4: 1755}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965511014_965511024 23 Left 965511014 3:169568019-169568041 CCAGCTCATCTCATTGGGACTCG 0: 3
1: 117
2: 371
3: 425
4: 297
Right 965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG 0: 12
1: 166
2: 439
3: 860
4: 1755
965511013_965511024 24 Left 965511013 3:169568018-169568040 CCCAGCTCATCTCATTGGGACTC 0: 2
1: 83
2: 391
3: 959
4: 1129
Right 965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG 0: 12
1: 166
2: 439
3: 860
4: 1755

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965511024 Original CRISPR GAGGGTGAGCAGAAGCAGGA TGG Intronic
Too many off-targets to display for this crispr