ID: 965511765 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:169575558-169575580 |
Sequence | GACAAGGCGGCATCCCCGGA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 57 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 52} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
965511765_965511770 | 11 | Left | 965511765 | 3:169575558-169575580 | CCGTCCGGGGATGCCGCCTTGTC | 0: 1 1: 0 2: 0 3: 4 4: 52 |
||
Right | 965511770 | 3:169575592-169575614 | TTACACAAACACCTCCACACTGG | 0: 1 1: 0 2: 0 3: 25 4: 290 |
||||
965511765_965511771 | 21 | Left | 965511765 | 3:169575558-169575580 | CCGTCCGGGGATGCCGCCTTGTC | 0: 1 1: 0 2: 0 3: 4 4: 52 |
||
Right | 965511771 | 3:169575602-169575624 | ACCTCCACACTGGACTTAGAAGG | 0: 1 1: 0 2: 2 3: 5 4: 103 |
||||
965511765_965511774 | 28 | Left | 965511765 | 3:169575558-169575580 | CCGTCCGGGGATGCCGCCTTGTC | 0: 1 1: 0 2: 0 3: 4 4: 52 |
||
Right | 965511774 | 3:169575609-169575631 | CACTGGACTTAGAAGGCTTTTGG | 0: 1 1: 0 2: 1 3: 10 4: 138 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
965511765 | Original CRISPR | GACAAGGCGGCATCCCCGGA CGG (reversed) | Intronic | ||