ID: 965511766

View in Genome Browser
Species Human (GRCh38)
Location 3:169575562-169575584
Sequence GCAGGACAAGGCGGCATCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965511766_965511770 7 Left 965511766 3:169575562-169575584 CCGGGGATGCCGCCTTGTCCTGC 0: 1
1: 0
2: 2
3: 18
4: 172
Right 965511770 3:169575592-169575614 TTACACAAACACCTCCACACTGG 0: 1
1: 0
2: 0
3: 25
4: 290
965511766_965511771 17 Left 965511766 3:169575562-169575584 CCGGGGATGCCGCCTTGTCCTGC 0: 1
1: 0
2: 2
3: 18
4: 172
Right 965511771 3:169575602-169575624 ACCTCCACACTGGACTTAGAAGG 0: 1
1: 0
2: 2
3: 5
4: 103
965511766_965511774 24 Left 965511766 3:169575562-169575584 CCGGGGATGCCGCCTTGTCCTGC 0: 1
1: 0
2: 2
3: 18
4: 172
Right 965511774 3:169575609-169575631 CACTGGACTTAGAAGGCTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965511766 Original CRISPR GCAGGACAAGGCGGCATCCC CGG (reversed) Intronic