ID: 965511767

View in Genome Browser
Species Human (GRCh38)
Location 3:169575571-169575593
Sequence AAGATAAAAGCAGGACAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 710
Summary {0: 1, 1: 0, 2: 10, 3: 57, 4: 642}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965511767_965511774 15 Left 965511767 3:169575571-169575593 CCGCCTTGTCCTGCTTTTATCTT 0: 1
1: 0
2: 10
3: 57
4: 642
Right 965511774 3:169575609-169575631 CACTGGACTTAGAAGGCTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 138
965511767_965511775 22 Left 965511767 3:169575571-169575593 CCGCCTTGTCCTGCTTTTATCTT 0: 1
1: 0
2: 10
3: 57
4: 642
Right 965511775 3:169575616-169575638 CTTAGAAGGCTTTTGGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 135
965511767_965511770 -2 Left 965511767 3:169575571-169575593 CCGCCTTGTCCTGCTTTTATCTT 0: 1
1: 0
2: 10
3: 57
4: 642
Right 965511770 3:169575592-169575614 TTACACAAACACCTCCACACTGG 0: 1
1: 0
2: 0
3: 25
4: 290
965511767_965511771 8 Left 965511767 3:169575571-169575593 CCGCCTTGTCCTGCTTTTATCTT 0: 1
1: 0
2: 10
3: 57
4: 642
Right 965511771 3:169575602-169575624 ACCTCCACACTGGACTTAGAAGG 0: 1
1: 0
2: 2
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965511767 Original CRISPR AAGATAAAAGCAGGACAAGG CGG (reversed) Intronic