ID: 965511769

View in Genome Browser
Species Human (GRCh38)
Location 3:169575580-169575602
Sequence TGTTTGTGTAAGATAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965511769_965511774 6 Left 965511769 3:169575580-169575602 CCTGCTTTTATCTTACACAAACA 0: 1
1: 0
2: 0
3: 21
4: 246
Right 965511774 3:169575609-169575631 CACTGGACTTAGAAGGCTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 138
965511769_965511775 13 Left 965511769 3:169575580-169575602 CCTGCTTTTATCTTACACAAACA 0: 1
1: 0
2: 0
3: 21
4: 246
Right 965511775 3:169575616-169575638 CTTAGAAGGCTTTTGGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 135
965511769_965511771 -1 Left 965511769 3:169575580-169575602 CCTGCTTTTATCTTACACAAACA 0: 1
1: 0
2: 0
3: 21
4: 246
Right 965511771 3:169575602-169575624 ACCTCCACACTGGACTTAGAAGG 0: 1
1: 0
2: 2
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965511769 Original CRISPR TGTTTGTGTAAGATAAAAGC AGG (reversed) Intronic