ID: 965511770

View in Genome Browser
Species Human (GRCh38)
Location 3:169575592-169575614
Sequence TTACACAAACACCTCCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965511765_965511770 11 Left 965511765 3:169575558-169575580 CCGTCCGGGGATGCCGCCTTGTC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 965511770 3:169575592-169575614 TTACACAAACACCTCCACACTGG 0: 1
1: 0
2: 0
3: 25
4: 290
965511767_965511770 -2 Left 965511767 3:169575571-169575593 CCGCCTTGTCCTGCTTTTATCTT 0: 1
1: 0
2: 10
3: 57
4: 642
Right 965511770 3:169575592-169575614 TTACACAAACACCTCCACACTGG 0: 1
1: 0
2: 0
3: 25
4: 290
965511766_965511770 7 Left 965511766 3:169575562-169575584 CCGGGGATGCCGCCTTGTCCTGC 0: 1
1: 0
2: 2
3: 18
4: 172
Right 965511770 3:169575592-169575614 TTACACAAACACCTCCACACTGG 0: 1
1: 0
2: 0
3: 25
4: 290
965511768_965511770 -5 Left 965511768 3:169575574-169575596 CCTTGTCCTGCTTTTATCTTACA 0: 1
1: 0
2: 1
3: 23
4: 291
Right 965511770 3:169575592-169575614 TTACACAAACACCTCCACACTGG 0: 1
1: 0
2: 0
3: 25
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965511770 Original CRISPR TTACACAAACACCTCCACAC TGG Intronic