ID: 965511770 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:169575592-169575614 |
Sequence | TTACACAAACACCTCCACAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 316 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 25, 4: 290} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
965511766_965511770 | 7 | Left | 965511766 | 3:169575562-169575584 | CCGGGGATGCCGCCTTGTCCTGC | 0: 1 1: 0 2: 2 3: 18 4: 172 |
||
Right | 965511770 | 3:169575592-169575614 | TTACACAAACACCTCCACACTGG | 0: 1 1: 0 2: 0 3: 25 4: 290 |
||||
965511768_965511770 | -5 | Left | 965511768 | 3:169575574-169575596 | CCTTGTCCTGCTTTTATCTTACA | 0: 1 1: 0 2: 1 3: 23 4: 291 |
||
Right | 965511770 | 3:169575592-169575614 | TTACACAAACACCTCCACACTGG | 0: 1 1: 0 2: 0 3: 25 4: 290 |
||||
965511767_965511770 | -2 | Left | 965511767 | 3:169575571-169575593 | CCGCCTTGTCCTGCTTTTATCTT | 0: 1 1: 0 2: 10 3: 57 4: 642 |
||
Right | 965511770 | 3:169575592-169575614 | TTACACAAACACCTCCACACTGG | 0: 1 1: 0 2: 0 3: 25 4: 290 |
||||
965511765_965511770 | 11 | Left | 965511765 | 3:169575558-169575580 | CCGTCCGGGGATGCCGCCTTGTC | 0: 1 1: 0 2: 0 3: 4 4: 52 |
||
Right | 965511770 | 3:169575592-169575614 | TTACACAAACACCTCCACACTGG | 0: 1 1: 0 2: 0 3: 25 4: 290 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
965511770 | Original CRISPR | TTACACAAACACCTCCACAC TGG | Intronic | ||