ID: 965511772

View in Genome Browser
Species Human (GRCh38)
Location 3:169575603-169575625
Sequence GCCTTCTAAGTCCAGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965511772_965511778 24 Left 965511772 3:169575603-169575625 CCTCCACACTGGACTTAGAAGGC 0: 1
1: 1
2: 0
3: 17
4: 116
Right 965511778 3:169575650-169575672 TATTCTGGGCTGCATCCAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 139
965511772_965511779 25 Left 965511772 3:169575603-169575625 CCTCCACACTGGACTTAGAAGGC 0: 1
1: 1
2: 0
3: 17
4: 116
Right 965511779 3:169575651-169575673 ATTCTGGGCTGCATCCAGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 189
965511772_965511775 -10 Left 965511772 3:169575603-169575625 CCTCCACACTGGACTTAGAAGGC 0: 1
1: 1
2: 0
3: 17
4: 116
Right 965511775 3:169575616-169575638 CTTAGAAGGCTTTTGGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 135
965511772_965511777 10 Left 965511772 3:169575603-169575625 CCTCCACACTGGACTTAGAAGGC 0: 1
1: 1
2: 0
3: 17
4: 116
Right 965511777 3:169575636-169575658 AGGCAGAGAACTGATATTCTGGG 0: 1
1: 0
2: 0
3: 21
4: 206
965511772_965511776 9 Left 965511772 3:169575603-169575625 CCTCCACACTGGACTTAGAAGGC 0: 1
1: 1
2: 0
3: 17
4: 116
Right 965511776 3:169575635-169575657 AAGGCAGAGAACTGATATTCTGG 0: 1
1: 0
2: 2
3: 26
4: 264
965511772_965511780 30 Left 965511772 3:169575603-169575625 CCTCCACACTGGACTTAGAAGGC 0: 1
1: 1
2: 0
3: 17
4: 116
Right 965511780 3:169575656-169575678 GGGCTGCATCCAGCTGGGAAAGG 0: 1
1: 0
2: 2
3: 29
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965511772 Original CRISPR GCCTTCTAAGTCCAGTGTGG AGG (reversed) Intronic