ID: 965511774

View in Genome Browser
Species Human (GRCh38)
Location 3:169575609-169575631
Sequence CACTGGACTTAGAAGGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965511765_965511774 28 Left 965511765 3:169575558-169575580 CCGTCCGGGGATGCCGCCTTGTC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 965511774 3:169575609-169575631 CACTGGACTTAGAAGGCTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 138
965511766_965511774 24 Left 965511766 3:169575562-169575584 CCGGGGATGCCGCCTTGTCCTGC 0: 1
1: 0
2: 2
3: 18
4: 172
Right 965511774 3:169575609-169575631 CACTGGACTTAGAAGGCTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 138
965511769_965511774 6 Left 965511769 3:169575580-169575602 CCTGCTTTTATCTTACACAAACA 0: 1
1: 0
2: 0
3: 21
4: 246
Right 965511774 3:169575609-169575631 CACTGGACTTAGAAGGCTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 138
965511768_965511774 12 Left 965511768 3:169575574-169575596 CCTTGTCCTGCTTTTATCTTACA 0: 1
1: 0
2: 1
3: 23
4: 291
Right 965511774 3:169575609-169575631 CACTGGACTTAGAAGGCTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 138
965511767_965511774 15 Left 965511767 3:169575571-169575593 CCGCCTTGTCCTGCTTTTATCTT 0: 1
1: 0
2: 10
3: 57
4: 642
Right 965511774 3:169575609-169575631 CACTGGACTTAGAAGGCTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965511774 Original CRISPR CACTGGACTTAGAAGGCTTT TGG Intronic