ID: 965511775

View in Genome Browser
Species Human (GRCh38)
Location 3:169575616-169575638
Sequence CTTAGAAGGCTTTTGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965511767_965511775 22 Left 965511767 3:169575571-169575593 CCGCCTTGTCCTGCTTTTATCTT 0: 1
1: 0
2: 10
3: 57
4: 642
Right 965511775 3:169575616-169575638 CTTAGAAGGCTTTTGGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 135
965511768_965511775 19 Left 965511768 3:169575574-169575596 CCTTGTCCTGCTTTTATCTTACA 0: 1
1: 0
2: 1
3: 23
4: 291
Right 965511775 3:169575616-169575638 CTTAGAAGGCTTTTGGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 135
965511772_965511775 -10 Left 965511772 3:169575603-169575625 CCTCCACACTGGACTTAGAAGGC 0: 1
1: 1
2: 0
3: 17
4: 116
Right 965511775 3:169575616-169575638 CTTAGAAGGCTTTTGGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 135
965511769_965511775 13 Left 965511769 3:169575580-169575602 CCTGCTTTTATCTTACACAAACA 0: 1
1: 0
2: 0
3: 21
4: 246
Right 965511775 3:169575616-169575638 CTTAGAAGGCTTTTGGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965511775 Original CRISPR CTTAGAAGGCTTTTGGCACA AGG Intronic