ID: 965514716

View in Genome Browser
Species Human (GRCh38)
Location 3:169608548-169608570
Sequence CTGGAAACACAAATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 257}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965514716_965514720 -5 Left 965514716 3:169608548-169608570 CCTCCCTCCATTTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 30
4: 257
Right 965514720 3:169608566-169608588 TCCAGTCATGTACCAGTGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 128
965514716_965514729 28 Left 965514716 3:169608548-169608570 CCTCCCTCCATTTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 30
4: 257
Right 965514729 3:169608599-169608621 TTCCCTTCAGGGCAGGCACACGG 0: 1
1: 0
2: 1
3: 33
4: 283
965514716_965514725 16 Left 965514716 3:169608548-169608570 CCTCCCTCCATTTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 30
4: 257
Right 965514725 3:169608587-169608609 GGCAAAAGGACCTTCCCTTCAGG 0: 1
1: 0
2: 1
3: 20
4: 153
965514716_965514727 21 Left 965514716 3:169608548-169608570 CCTCCCTCCATTTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 30
4: 257
Right 965514727 3:169608592-169608614 AAGGACCTTCCCTTCAGGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 178
965514716_965514726 17 Left 965514716 3:169608548-169608570 CCTCCCTCCATTTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 30
4: 257
Right 965514726 3:169608588-169608610 GCAAAAGGACCTTCCCTTCAGGG 0: 1
1: 0
2: 4
3: 30
4: 251
965514716_965514722 2 Left 965514716 3:169608548-169608570 CCTCCCTCCATTTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 30
4: 257
Right 965514722 3:169608573-169608595 ATGTACCAGTGCCTGGCAAAAGG 0: 1
1: 0
2: 1
3: 31
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965514716 Original CRISPR CTGGAAACACAAATGGAGGG AGG (reversed) Intronic
900561500 1:3309277-3309299 CTGGGAACACTAATGGTGGAGGG + Intronic
900887944 1:5428790-5428812 AGAGAAACAGAAATGGAGGGAGG + Intergenic
901687144 1:10949299-10949321 CTATGCACACAAATGGAGGGAGG - Intronic
902706757 1:18210751-18210773 CTGCTATCACAACTGGAGGGGGG - Intronic
906532424 1:46531448-46531470 TTGGAAACAGAAAGGGAGGCTGG + Intergenic
911089823 1:94009566-94009588 CTGGAAACACATGCGGAGGCTGG - Intronic
912848746 1:113103000-113103022 CTGGCAAAAAAAAAGGAGGGGGG - Intronic
913254432 1:116941061-116941083 GTGGAAGCACAAAGGGAGAGAGG - Intronic
916416727 1:164599360-164599382 AAAGAAACAAAAATGGAGGGGGG - Intronic
916673099 1:167042545-167042567 ATGGAAACTCAATTGGAGGGTGG + Intergenic
917211237 1:172633949-172633971 CAGGAAAGACAAATGCAGAGAGG + Intergenic
917509415 1:175657996-175658018 CTGGGAACCCAAGTGGAGGTAGG - Intronic
918203779 1:182291296-182291318 CAGGAAATACATATGGAGGGGGG + Intergenic
920358138 1:205391415-205391437 CTGGAAACACCAAGGGATGCAGG + Intronic
922243750 1:223775174-223775196 CAGGAAAAAAAAATGCAGGGAGG + Exonic
922575388 1:226657951-226657973 CTGGGAACAGACTTGGAGGGAGG - Intronic
923951805 1:238964180-238964202 AAGGAAACAGAAATGTAGGGGGG - Intergenic
924185519 1:241485169-241485191 CTGGATGCCCAAATGGTGGGAGG + Intergenic
1062836004 10:636073-636095 CTGGAAACACACATGTAGTGTGG - Intronic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064924114 10:20551160-20551182 CTGGAAAGAATAAGGGAGGGTGG - Intergenic
1067529018 10:47056992-47057014 CGGGAAACACCAATGTTGGGAGG + Intergenic
1069416811 10:68207860-68207882 GTGGAAACTCACAGGGAGGGTGG - Intronic
1070796138 10:79217697-79217719 CTGGAAACATACATGGAAAGAGG - Intronic
1072304872 10:94097505-94097527 CTGGAAGCTCAAAGGGAAGGAGG - Intronic
1073043471 10:100622603-100622625 CTGGAAAGACTCAAGGAGGGAGG - Intergenic
1073428409 10:103470541-103470563 GTGGAAAGAAAGATGGAGGGAGG - Intergenic
1073560903 10:104496037-104496059 CTGGGGCCACATATGGAGGGAGG - Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074364922 10:112849988-112850010 CTGGAAACAAAAGAGGAAGGTGG + Intergenic
1075672945 10:124276511-124276533 CTGGAAAAGCAAATGCACGGGGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1078107215 11:8365881-8365903 CTGGAAGGACAAATGGAGAGGGG - Intergenic
1083087046 11:60159998-60160020 CTGGAAAAAAAAATGTTGGGGGG + Intergenic
1084036617 11:66515301-66515323 CTGGAAACACCAAGAGAGGAGGG + Intronic
1084353281 11:68618921-68618943 CTTGAAAGACAAATGGGCGGGGG - Intergenic
1084595755 11:70116135-70116157 CCAGAAACACAAATGAAAGGGGG - Intronic
1085137769 11:74109120-74109142 CTGGAAACACAAATCGCTGCTGG + Exonic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1086943347 11:92820631-92820653 CTGGAAGCTCAAATGGAGGTTGG - Intronic
1087657975 11:100949250-100949272 CTGGTAACACAGTTTGAGGGAGG - Intronic
1087792719 11:102423812-102423834 TTGGGAAGACAAAGGGAGGGAGG + Intronic
1087860259 11:103144787-103144809 CTGGAAACACAGATATACGGTGG + Intronic
1088393858 11:109345859-109345881 GTGAAAACACAAAGGGATGGAGG - Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089093849 11:115901462-115901484 CTGGAAACAGAAAAGGATGATGG - Intergenic
1090886240 11:130879371-130879393 TTCCAAACACAAATGGTGGGTGG + Intronic
1090899125 11:131010489-131010511 CTTGAACCACACATGCAGGGAGG - Intergenic
1091352605 11:134909120-134909142 CAGGAAACACAAATGAAAGATGG - Intergenic
1091370498 11:135053687-135053709 CCAGAAACACAAATGGTGGAAGG - Intergenic
1091504162 12:1050078-1050100 CTGGAAAAGCAAATGGATGTGGG + Intronic
1092189378 12:6507290-6507312 CAGGGAACAAAAATGAAGGGAGG + Intronic
1095308588 12:40667418-40667440 GTGGAAAAACAACTGAAGGGTGG + Intergenic
1096197555 12:49658336-49658358 CTGGAAGCAAGAGTGGAGGGAGG + Intronic
1098987153 12:77024938-77024960 CTTGAACTACAAATGGAGGTTGG + Intronic
1102607097 12:114076346-114076368 ACGGAAAGACAAGTGGAGGGAGG + Intergenic
1102657224 12:114492173-114492195 GCTGAAAAACAAATGGAGGGAGG + Intergenic
1104144485 12:126019307-126019329 ATGGAAACACAAAGGGAGCTGGG + Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104354611 12:128074313-128074335 CTGGAAACAGAAAATGAGGGAGG + Intergenic
1104570213 12:129918417-129918439 CTGCAAACAGAACTTGAGGGTGG + Intergenic
1106231452 13:27824178-27824200 CAGGAAAAAAAAATGCAGGGTGG - Intergenic
1106417187 13:29555658-29555680 CTGGAAAAAAAAAGGGGGGGCGG + Intronic
1106777136 13:33019486-33019508 GTGGAAACACAGAGGGAGTGAGG - Intronic
1107203669 13:37754254-37754276 ATGGAACCACAAAAGGAAGGAGG - Intronic
1107931043 13:45307671-45307693 CTGTTGACAGAAATGGAGGGAGG + Intergenic
1108119160 13:47164569-47164591 CTGGAAACACATATGTTGGTTGG - Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108853125 13:54760417-54760439 CTTTAAATACAAATAGAGGGTGG - Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109941422 13:69371335-69371357 CTGGGACTACTAATGGAGGGAGG + Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1113532416 13:111037884-111037906 ATGGAAGGAGAAATGGAGGGCGG + Intergenic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1114134321 14:19829735-19829757 CTGGAACCCCAAATGCAAGGGGG + Intergenic
1115002160 14:28435803-28435825 GTGGAAGAACAAATGGAGAGTGG + Intergenic
1116630985 14:47332812-47332834 TTGGAAACTCAAATGGTAGGAGG - Intronic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1119461432 14:74807643-74807665 TTGGGAAAACAAATGGAAGGAGG + Intronic
1121309434 14:92927433-92927455 CTGGAAACTCAAAACCAGGGTGG - Intronic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123577380 15:21685327-21685349 CTGGAACCCCAAATGCAAGGGGG + Intergenic
1123614002 15:22127797-22127819 CTGGAACCCCAAATGCAAGGGGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1127447438 15:59079046-59079068 TTGGGAACACAAATAGAGGAAGG + Intronic
1128219467 15:65958028-65958050 ATGGAAACCAAAATGGAGAGTGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128704352 15:69827829-69827851 CTGGGAACACAAATGGACCAAGG - Intergenic
1128809347 15:70559378-70559400 CTGGAGACAGAAGGGGAGGGAGG + Intergenic
1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG + Intronic
1129362388 15:75032060-75032082 GGGGAAAAACAAATGCAGGGAGG - Intronic
1130542284 15:84829103-84829125 CTGGGAAGACAAATTGAGAGGGG - Intronic
1131237181 15:90706705-90706727 CTGTAAATAGAAGTGGAGGGAGG + Intergenic
1131261544 15:90890506-90890528 CTCGAAACACAACAGTAGGGGGG - Intronic
1202986249 15_KI270727v1_random:419572-419594 CTGGAACCCCAAATGCAAGGGGG + Intergenic
1132703071 16:1230199-1230221 CTGGAAGCATAAATGGGGAGGGG - Intergenic
1132708380 16:1256032-1256054 CTGGAAGCATAAATGGGGAGGGG + Intergenic
1135856852 16:26019597-26019619 TTGGAAACACACAGGGAGGGCGG + Intronic
1135871548 16:26155998-26156020 ATGGAAACACAAAAGTAGAGAGG - Intergenic
1137402671 16:48165920-48165942 CTGTAACCACATGTGGAGGGTGG + Intergenic
1137858719 16:51823358-51823380 CTGGAAGCAGGAGTGGAGGGAGG - Intergenic
1139261196 16:65595853-65595875 TTGGAAACACAATGGGAGGTGGG - Intergenic
1140662607 16:77201905-77201927 ATTGAAACAAAAATGGAGGGGGG + Exonic
1143332089 17:6144953-6144975 CTGGAAACAAGAATGGAAGATGG - Intergenic
1143410707 17:6706767-6706789 CTGGACACACACCTGGAGCGTGG + Exonic
1143862365 17:9900197-9900219 CTGCAAACACATATGGCTGGAGG - Intronic
1144654281 17:17025382-17025404 CAGGAAACACCAATAGAGGAGGG + Intergenic
1146420203 17:32677937-32677959 CTGGAAGGACACCTGGAGGGCGG - Intronic
1146494688 17:33311096-33311118 CTGGAAAGAGAAAGAGAGGGAGG + Intronic
1148392009 17:47279495-47279517 CAGCAACCACAAAGGGAGGGAGG + Intronic
1148900103 17:50868911-50868933 CTGGAAAAAGCAATGAAGGGTGG + Intergenic
1149569920 17:57665137-57665159 CTGGGAAGACTAATGGAGGCTGG - Intronic
1152062730 17:78090512-78090534 CTGGAAATACAAGGGGAGGGGGG + Intronic
1152127143 17:78454059-78454081 CTGGAAAATCCAATGGCGGGTGG - Intronic
1152807221 17:82361857-82361879 CTGGAAAGGCAAAGGAAGGGAGG - Intronic
1152914637 17:83027134-83027156 CTGGACAGACACACGGAGGGGGG + Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1156095866 18:33531078-33531100 CTGGGAACAGACATGGAGTGGGG + Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157343799 18:46805016-46805038 CTGGAAACAAAAAAGGATGGAGG + Intergenic
1158930634 18:62322454-62322476 ATGGTAGCACAAAGGGAGGGAGG + Intergenic
1159080501 18:63730659-63730681 CTGGAAAGAGGAATTGAGGGGGG + Intergenic
1159712144 18:71774059-71774081 CTGGAAACTAAAATGGGGGAGGG - Intronic
1160211261 18:76882060-76882082 CTAGAAGCACAGAGGGAGGGCGG - Intronic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1162547323 19:11338755-11338777 CTGGAAAGACCAAGGGTGGGCGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
925779822 2:7371979-7372001 CTGGGAAGACAAATGGAGACTGG + Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926812269 2:16765588-16765610 CTGCACACACAAAGGGAAGGGGG - Intergenic
927232827 2:20842294-20842316 CTGGCCACACAAATAGAGTGTGG - Intergenic
928622464 2:33104790-33104812 TTAGAAACAGAAATGCAGGGTGG - Intronic
928838919 2:35581611-35581633 GTGTATACACAAAAGGAGGGGGG + Intergenic
930243450 2:48959426-48959448 CTGCAAGAGCAAATGGAGGGAGG - Intergenic
931807222 2:65818885-65818907 CCAGAAACACAAATGGAATGCGG - Intergenic
933798918 2:85944284-85944306 CTAGAAAGAGAAATGGAAGGTGG - Intergenic
934039921 2:88119344-88119366 CTGGGAACAGAACTGGTGGGAGG - Intergenic
935296739 2:101656386-101656408 CTGGAAACAGACCTGGAGGTGGG - Intergenic
936824044 2:116558756-116558778 TTGGAAACCCAAATTGAGGGGGG + Intergenic
937213947 2:120298574-120298596 TTGGAAAAACACAGGGAGGGAGG - Intergenic
937256846 2:120561674-120561696 CAGGAAAGAGAAAGGGAGGGAGG - Intergenic
938023102 2:127922218-127922240 TTGGAAATGCAAATGTAGGGAGG - Intergenic
939682811 2:145159879-145159901 CAGGAAACACTAGTTGAGGGTGG + Intergenic
941833546 2:169990579-169990601 ATAGAAACACAAAGGGAAGGGGG + Intronic
942767910 2:179479039-179479061 TTGGAAACATAATGGGAGGGAGG - Intronic
943763892 2:191639475-191639497 CTGGAATCATACATGGAGGATGG + Intergenic
943796605 2:192004256-192004278 GTGGAAACACAAATAAAAGGAGG - Intronic
944507235 2:200425138-200425160 CAGGAAGCACAAATGGCGGGGGG - Intronic
946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG + Intronic
946484101 2:220084514-220084536 CTGGAAACACAAATCCAGGCTGG + Intergenic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947229244 2:227868712-227868734 CTGGAAGGACTTATGGAGGGAGG - Intergenic
947315345 2:228851625-228851647 CTGGAGACAGGACTGGAGGGGGG + Intronic
948173087 2:235922049-235922071 CTGGAATCACAACTGGATGAAGG - Intronic
1170327453 20:15172255-15172277 GTGGAAAAAAAAATGGAGGTTGG + Intronic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1174925159 20:54751049-54751071 CTGGAAACAGACTTTGAGGGAGG - Intergenic
1175709622 20:61208963-61208985 CTGGAAAAAAAAAAGGGGGGGGG - Intergenic
1177540604 21:22488957-22488979 CTGCAAACACTACTGGAGAGGGG + Intergenic
1177962955 21:27691600-27691622 CTAGAATCACAAGTGGAGGGAGG + Intergenic
1178148206 21:29764051-29764073 TCGGAAACATAATTGGAGGGAGG + Intronic
1178263224 21:31118814-31118836 CTGGAAACCCGAAAGGCGGGGGG + Exonic
1179071339 21:38073845-38073867 CTAGAAACAGAAGTGGAGAGTGG + Intronic
1179311085 21:40196689-40196711 CAGGAGACAGAAATAGAGGGAGG - Intronic
1179382839 21:40915320-40915342 CTGCAAACTCACATGGAGGGTGG - Intergenic
1179486273 21:41712593-41712615 CTGGAGAGACAAAGGGAGGTGGG - Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180750497 22:18121218-18121240 CAGGAAAGAAAAAAGGAGGGTGG - Intronic
1181364812 22:22367730-22367752 CTGGAGACAGAAGTGGATGGAGG + Intergenic
1182210230 22:28670085-28670107 CTGAAAATAAAAATGGGGGGGGG + Intronic
1182527839 22:30932686-30932708 CTTGATACACAACAGGAGGGCGG - Exonic
949563023 3:5220420-5220442 GTGGCAACACACAGGGAGGGAGG - Intergenic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950143698 3:10632949-10632971 GAGGACACTCAAATGGAGGGGGG + Intronic
950383527 3:12637573-12637595 CTTAAAACACAAATGGAGGCCGG + Intronic
952962000 3:38598177-38598199 CAGGAAACAAAGATGGAGGTGGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954294654 3:49667567-49667589 CTTGAAAGAGAAAAGGAGGGAGG - Intronic
955052285 3:55424354-55424376 CTGGAAACACCCATGGGGTGGGG + Intergenic
959328281 3:104967385-104967407 CTGGAAAGAGTAATGGAGAGAGG - Intergenic
960864466 3:122185057-122185079 CAGGAAATACACATGGAGGCTGG - Intronic
963768951 3:149368950-149368972 CTGGAAAAAAAAAAGGGGGGGGG + Intergenic
964008439 3:151860055-151860077 CTGGAAAAAGGAATGGAGGCAGG + Intergenic
964269994 3:154945342-154945364 CTGGAAGCACAAGGGGTGGGGGG + Intergenic
965094725 3:164210439-164210461 CTGGTTACAGAAATGGACGGTGG - Intergenic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965858765 3:173121327-173121349 CTGAAAACACACATTGAGCGAGG - Intronic
966585118 3:181615149-181615171 GAGGAAACAAAAAAGGAGGGAGG + Intergenic
967597950 3:191349970-191349992 CAGGAAAAAAAAAGGGAGGGGGG - Intronic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
971133103 4:23835413-23835435 CTGGAAACACAATGAGAGGGAGG + Intronic
972958629 4:44423618-44423640 TTCTAAAGACAAATGGAGGGTGG + Intronic
974148866 4:57979900-57979922 CTGGAAAGATATCTGGAGGGTGG + Intergenic
979275360 4:118809306-118809328 ATGGACACAGAAAAGGAGGGAGG + Intronic
981174233 4:141661776-141661798 CAAAAAACAGAAATGGAGGGCGG - Intronic
981471497 4:145140545-145140567 TTGGAAACTAAAAAGGAGGGAGG + Intronic
982161509 4:152574622-152574644 CTGAAAACACCAATGTAAGGAGG - Intergenic
985324070 4:188747761-188747783 CTGGACACACAAAAGATGGGAGG - Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
989090559 5:37725878-37725900 CTGGAAAGACAATTGGACAGTGG - Intronic
989456301 5:41648199-41648221 GTGGAATCTCAAAGGGAGGGTGG + Intergenic
991575821 5:68102412-68102434 CTGGAAGCACAAGGGGTGGGGGG + Intergenic
992137113 5:73758050-73758072 CTGGGAACACAAGTGGAGGGAGG - Intronic
992399825 5:76402408-76402430 CAGGAAAAACAAACTGAGGGAGG - Intergenic
995405114 5:111785951-111785973 CTGGAAAGAAAAATGAAGAGAGG + Intronic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
997522577 5:134532693-134532715 CTGCAAACACACTTGGGGGGTGG - Intronic
997813022 5:136990547-136990569 CTGGAAAAAAAAAAAGAGGGGGG - Intronic
1000700168 5:164439608-164439630 ATGAAAACCTAAATGGAGGGGGG + Intergenic
1000786294 5:165548581-165548603 CTGGAAACAGGAGTGGAAGGTGG + Intergenic
1001905524 5:175469586-175469608 AGGAAAACAGAAATGGAGGGCGG + Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1004790328 6:19018968-19018990 ATGAAAAAACAAATGGTGGGAGG + Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1005626448 6:27666947-27666969 CGGGAAACACAATTGAAGGTGGG + Intergenic
1006233085 6:32602157-32602179 CTGAAAGCAAAAATGGAGGCTGG + Intergenic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1010658305 6:78538805-78538827 CTGGGAACAAAAATGGAGGCAGG + Intergenic
1011420723 6:87169335-87169357 CTGGAAAAAAAAAAGGAGGCTGG - Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1016886632 6:148965226-148965248 TTGGTAACAAAAACGGAGGGCGG + Intronic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1019372316 7:669095-669117 ATGGATACACAAATGGGGTGTGG + Intronic
1021870776 7:25004117-25004139 CTGGGAACTCAGATGTAGGGAGG - Intergenic
1023117722 7:36878638-36878660 CTGGTAATACACATGGTGGGTGG + Intronic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1031155111 7:118100825-118100847 TTGGAGACACAAAAGGCGGGAGG - Intergenic
1032006378 7:128305240-128305262 CTGGCAACTCAAGTGGAGGGAGG - Exonic
1032720284 7:134546053-134546075 ATAGAAAGACAAATGGAAGGAGG + Intergenic
1033451015 7:141462503-141462525 CTGGAAAGACCAGTGGAGGGTGG + Intronic
1033828426 7:145221403-145221425 CTGGTATCACAAATGAAGGAAGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035573790 8:691119-691141 TAGGAAACACAATTAGAGGGTGG + Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037272754 8:17147385-17147407 CTGGAAGGACAAAGGGAAGGTGG - Intergenic
1037316695 8:17605958-17605980 CAGACAACACAAAGGGAGGGTGG + Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1039764962 8:40618893-40618915 CAGGAAACACTAATGGGGAGTGG + Intronic
1040788734 8:51199064-51199086 CTGAAAATACAAATGGCTGGGGG - Intergenic
1041449034 8:57987927-57987949 CTGGAATCAAAAATCAAGGGTGG - Intergenic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1042281801 8:67064070-67064092 CTGGAAAGAAAAATGGGGAGGGG - Intronic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1048421012 8:134278300-134278322 ATGGAAACAGAAGTGCAGGGTGG + Intergenic
1048739879 8:137544210-137544232 CTGGAAACCAAAAAGCAGGGAGG - Intergenic
1049441760 8:142612842-142612864 CCGGAAAGACAGACGGAGGGAGG + Exonic
1050746265 9:8879775-8879797 ATAGAAACACAAACGGAGAGAGG + Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058394017 9:104528881-104528903 CTGGAAGCACAAAAGGAATGGGG + Intergenic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060983055 9:127804442-127804464 CGGGAATCACAAATGGGGGTGGG - Intronic
1185431185 X:13006-13028 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185431987 X:16686-16708 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185440452 X:225403-225425 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1186189185 X:7052563-7052585 ATGGAAAGAAAAAGGGAGGGAGG - Intronic
1186215312 X:7293742-7293764 CTGGAAACTCAAATAGAAAGTGG - Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187258898 X:17667298-17667320 CCAGAAGCACAAATGGAGAGAGG + Intronic
1188844979 X:35061270-35061292 CTGGAAGGGCAACTGGAGGGAGG + Intergenic
1188861020 X:35256368-35256390 CTGGAAACAAAAGTGGGGTGGGG + Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1193144128 X:78059886-78059908 CTGGAAACAGAAATGGGTGTGGG - Intergenic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1195091615 X:101464876-101464898 TTGGAATCACAGATGGAGTGCGG + Intronic
1195879767 X:109580407-109580429 ATGGAAACAGAAATGCAGGAAGG - Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1198462973 X:136880803-136880825 TTTGAAACGCAAAGGGAGGGGGG + Intergenic
1199500973 X:148505045-148505067 CGGGAAAGATAAATGGATGGAGG - Intronic
1199514771 X:148663874-148663896 ATGGGAACATAAAGGGAGGGAGG + Intronic
1200100141 X:153686097-153686119 CTGGAGACAGAAGTGAAGGGTGG - Intronic
1201585917 Y:15560907-15560929 CTAGAAATACAAAAGGAGGCTGG - Intergenic
1201773192 Y:17638416-17638438 CTGAAAACAGAAATAGAAGGTGG + Intergenic
1201828363 Y:18267570-18267592 CTGAAAACAGAAATAGAAGGTGG - Intergenic