ID: 965516083

View in Genome Browser
Species Human (GRCh38)
Location 3:169622474-169622496
Sequence GCGTGTGACCCAAAGTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965516083_965516085 16 Left 965516083 3:169622474-169622496 CCCACTTACTTTGGGTCACACGC 0: 1
1: 0
2: 0
3: 4
4: 53
Right 965516085 3:169622513-169622535 TCAGAGTGAGCAAGAGCAGAAGG 0: 1
1: 0
2: 2
3: 43
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965516083 Original CRISPR GCGTGTGACCCAAAGTAAGT GGG (reversed) Intronic
901490429 1:9593784-9593806 GCCTGTCACCCAAAGTCAGTTGG + Intronic
909319179 1:74261220-74261242 TTATGTGAGCCAAAGTAAGTGGG - Intronic
910625922 1:89306229-89306251 GAGTGGGACCCAGAGTGAGTGGG - Intergenic
915135445 1:153728289-153728311 GCGTCTGACCCTAAGAAAGGAGG - Exonic
921057369 1:211553445-211553467 GCCTGGGACCCCAAGTAACTGGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1070985960 10:80690085-80690107 GCCTGAGCCCTAAAGTAAGTGGG + Intergenic
1074753618 10:116609276-116609298 CCGTGTGACCCAAAGTTAACGGG - Intergenic
1089260936 11:117223610-117223632 GGGTGTGACCCACAGTAGATGGG - Intronic
1090519749 11:127465529-127465551 GCCCCTGACCCAGAGTAAGTTGG - Intergenic
1104070205 12:125338137-125338159 GTGCCTGGCCCAAAGTAAGTAGG - Intronic
1105347496 13:19587494-19587516 GGGTGAGACCCAAAGCAAGGAGG - Intergenic
1107479872 13:40777276-40777298 GGGTGAGACCCAAAGCAAGGAGG - Intergenic
1108622873 13:52201186-52201208 GGGTGAGACCCAAAGCAAGGAGG - Intergenic
1108663855 13:52609856-52609878 GGGTGAGACCCAAAGCAAGGAGG + Intergenic
1110275132 13:73634250-73634272 GGGTGTGTCCCAGAGGAAGTTGG + Intergenic
1127263439 15:57342969-57342991 GCGTTTACCCCAAAGTAATTTGG - Intergenic
1128150402 15:65359932-65359954 GCGAGTGACCCACAGCAGGTAGG + Intronic
1141500151 16:84438516-84438538 GCGTGTGACCCAAGCTGAGCTGG - Intronic
1142628560 17:1208281-1208303 GCCTGTGACCCGAAGGAACTAGG + Intronic
1146354335 17:32121207-32121229 GCCTGGCACCCAAAGTACGTGGG + Intergenic
1149102751 17:52925923-52925945 GCCTGTGGTCCAAAGTAGGTAGG + Intergenic
1150205370 17:63401220-63401242 GTCTGTGACCCAAAGCTAGTTGG + Intronic
1158161061 18:54484043-54484065 GAGTGTGAACCAAAGCAGGTGGG + Intergenic
1160563671 18:79773928-79773950 TCGTGGGGCCCAAAGGAAGTGGG + Intergenic
1162352508 19:10159111-10159133 GCGTGTGACCCTCAGGATGTGGG + Intronic
925301184 2:2813802-2813824 GGCTGTAAGCCAAAGTAAGTAGG + Intergenic
929173101 2:38950871-38950893 GCCTGTGACTCACAGTATGTTGG + Intronic
930229464 2:48828147-48828169 GCATTTGACCCAAAGAAAGGAGG + Intergenic
948461529 2:238132174-238132196 GGGTGTGACCCAAGGTCAGCAGG - Exonic
1170204410 20:13783329-13783351 GCATGTGACCCAGAATACGTTGG - Intronic
1175608076 20:60327853-60327875 GGCTGTGACCCAAGGAAAGTGGG - Intergenic
1180753799 22:18146045-18146067 GCAAGTGACCCAAAGCAAGCAGG - Intronic
1181856586 22:25785478-25785500 GCGTGTGGTCCAAGGTAAGGAGG + Exonic
1183752882 22:39732115-39732137 GTGTGTGCCCCAAAGTAAATAGG - Intergenic
949114892 3:309057-309079 GCGTGTGACCCACAGCCAGCCGG - Intronic
956319729 3:67983562-67983584 GCCTGTGACCCAGAGTATTTCGG - Intergenic
956619330 3:71205100-71205122 GCTAGTGACCCACAGTAAATGGG + Intronic
965516083 3:169622474-169622496 GCGTGTGACCCAAAGTAAGTGGG - Intronic
966150345 3:176861455-176861477 GAGTGTGACCCAAAGCAGGGTGG + Intergenic
969356613 4:6631308-6631330 GCAAGTGACCCAAAGCAAGCAGG - Intergenic
976978009 4:91187124-91187146 GAGTGTGAGCCAAAGCAAGGTGG - Intronic
983874163 4:172856972-172856994 ATGTGTGGCCCAAAGTAATTTGG - Intronic
1005172766 6:23006931-23006953 GCGTGTGACCCAAATTAATGAGG + Intergenic
1005907084 6:30272114-30272136 GCCTGTGTACCTAAGTAAGTAGG + Intergenic
1008050096 6:46892241-46892263 CCATGTGAACCAAAGTAAATGGG + Intronic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1009998620 6:70925322-70925344 GAGTGTGAGCCAAAGTAGGGCGG + Intronic
1017671322 6:156772057-156772079 GCTTGTGACCCAAAAGCAGTGGG - Intergenic
1029239068 7:99145654-99145676 GTGTGTGTCCCAAGGAAAGTAGG + Intergenic
1045113956 8:98962145-98962167 GGGTTTGACCCAAAGGAAATTGG + Intergenic
1052793435 9:32899986-32900008 AAGTGTGAACCCAAGTAAGTGGG - Intergenic
1052813971 9:33085590-33085612 GAGTGTGAGCCAAAGCAAGGTGG + Intergenic
1187033635 X:15514379-15514401 GTGTTTGGCCCAGAGTAAGTAGG - Intronic
1192226143 X:69229285-69229307 GCAAGTGACCCAAAGTGGGTCGG + Intergenic
1193388001 X:80893585-80893607 GAGTGTGAGCCAAAGTAGGATGG - Intergenic
1198819558 X:140633064-140633086 GAGTGTGAGCCAAAGTAAGGTGG + Intergenic
1199779052 X:151041410-151041432 GAGTGTGAGCCAAAGTAGGGTGG - Intergenic