ID: 965516523

View in Genome Browser
Species Human (GRCh38)
Location 3:169627828-169627850
Sequence CAATTAGGAAATCAGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965516518_965516523 9 Left 965516518 3:169627796-169627818 CCTTTACCATAAAGCACGTTTAT 0: 1
1: 0
2: 2
3: 7
4: 93
Right 965516523 3:169627828-169627850 CAATTAGGAAATCAGGAAAGAGG 0: 1
1: 0
2: 0
3: 32
4: 360
965516519_965516523 3 Left 965516519 3:169627802-169627824 CCATAAAGCACGTTTATAAACAA 0: 1
1: 0
2: 4
3: 17
4: 162
Right 965516523 3:169627828-169627850 CAATTAGGAAATCAGGAAAGAGG 0: 1
1: 0
2: 0
3: 32
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965516523 Original CRISPR CAATTAGGAAATCAGGAAAG AGG Intronic
900111702 1:1009379-1009401 GCATTAAGAAATCAGGAAACGGG + Intergenic
900270490 1:1784766-1784788 CAGTTTGGAAAGCAGGGAAGTGG + Intergenic
901170051 1:7250377-7250399 CAGTTAGGAACGCAGGGAAGTGG - Intronic
904021612 1:27470943-27470965 CAAGTAGGATATCAGTGAAGCGG + Intronic
904137381 1:28324039-28324061 CACTTAGCAAATGAGGAAATAGG - Intergenic
905827321 1:41035673-41035695 CAATTAAGAATATAGGAAAGAGG - Intronic
908337569 1:63143123-63143145 CAAATACAAAATCAGGAACGGGG - Intergenic
909440022 1:75686703-75686725 GAAGTAGGAAATCAGGAAATTGG + Intergenic
909513477 1:76481358-76481380 CATTTAGCAAATCAGGAAACTGG - Intronic
909797836 1:79765440-79765462 CAATTAATTAATCAAGAAAGAGG - Intergenic
911221245 1:95249683-95249705 CAGTTAGGAAATCAGAAACTAGG + Intergenic
911269217 1:95780313-95780335 AAATTAGGAAATGAGGATAATGG - Intergenic
911878310 1:103198400-103198422 AAAATAGCAAATCAGGAAGGTGG + Intergenic
912258057 1:108081270-108081292 CAATTCATACATCAGGAAAGGGG - Intergenic
912450643 1:109765542-109765564 GAAGAGGGAAATCAGGAAAGAGG + Intronic
914197112 1:145453246-145453268 CAGTCAGGGAAGCAGGAAAGGGG + Intergenic
914801221 1:150964081-150964103 CAAGTAAGGAGTCAGGAAAGGGG + Exonic
914819594 1:151090617-151090639 TAAGTAAGAAAACAGGAAAGTGG - Intronic
916488034 1:165276754-165276776 CAATTAGGAAGTTAAGAAGGAGG + Intronic
918205970 1:182309801-182309823 GGATTAGGAAGTCAGGCAAGGGG + Intergenic
918529258 1:185500119-185500141 CACTTATGACTTCAGGAAAGTGG - Intergenic
918809614 1:189099309-189099331 CGGTTAGGAAAACAGGAAATAGG + Intergenic
919015656 1:192031110-192031132 GAATTTGGAGTTCAGGAAAGGGG - Intergenic
920413062 1:205777290-205777312 CAATTTGCAAATCAGAGAAGAGG - Intergenic
921171543 1:212554372-212554394 TAATTAGGACATAAGGAAACAGG - Intergenic
922111667 1:222563949-222563971 GATTTATAAAATCAGGAAAGGGG + Intronic
922997475 1:229976028-229976050 CTTTTAGGAAATCTCGAAAGAGG - Intergenic
924498457 1:244613013-244613035 ACATTAGGAAATAAGGAAATAGG + Intronic
924826780 1:247548065-247548087 CAATGAGGAAATCAGGACTGAGG - Intronic
1062794363 10:332461-332483 CAATTAGGAAATCATGAGTTGGG - Intronic
1063123768 10:3123038-3123060 CAAGAAGGAAATCATGAGAGAGG - Intronic
1067375503 10:45724504-45724526 TGATTAGGTAACCAGGAAAGAGG - Intergenic
1067883316 10:50066130-50066152 TGATTAGGTAACCAGGAAAGAGG - Intergenic
1068300599 10:55133569-55133591 GAATCCAGAAATCAGGAAAGAGG - Intronic
1070155380 10:73831178-73831200 CAATTTGGAAAACAGAGAAGGGG + Intronic
1071114938 10:82207025-82207047 CAATTAGGAAAGCAGAAATGTGG - Intronic
1071871543 10:89800542-89800564 CAATTAGTAACTAAGAAAAGGGG + Intergenic
1071936580 10:90538255-90538277 CAATCAGGACAACAGGCAAGAGG + Intergenic
1073272457 10:102276825-102276847 CAATTAGGTAAAAAGGAAATAGG - Intronic
1074353949 10:112765112-112765134 CAATTAGTAAACTAGGAAACAGG - Intronic
1074671554 10:115797668-115797690 CAATAAACAAAGCAGGAAAGTGG + Intronic
1075682720 10:124343944-124343966 CCCTCAGCAAATCAGGAAAGGGG + Intergenic
1075846251 10:125547109-125547131 CAATTATAAAATCAGTTAAGTGG - Intergenic
1076708535 10:132317427-132317449 CAATTAAGAAAACAGACAAGGGG + Intronic
1078576599 11:12508143-12508165 CAACTAGGAATTCAGACAAGAGG - Intronic
1079387320 11:19992088-19992110 CAACTAGGAGAAGAGGAAAGGGG - Intronic
1081290794 11:41323105-41323127 CACTTTGGAAATCATTAAAGAGG - Intronic
1081763912 11:45595937-45595959 AGCTTAGGAAATCAGGAAGGAGG + Intergenic
1081888681 11:46521600-46521622 CAATTTGGAAATCATAATAGAGG - Intronic
1081918421 11:46749520-46749542 CAGTTTGGAAATCAGGAAGGAGG + Intronic
1082742146 11:56922889-56922911 CAATTAGGAATCCAGGAAGTGGG - Intergenic
1084860973 11:72018025-72018047 CAATTATGGGATAAGGAAAGGGG + Intronic
1085806414 11:79641063-79641085 CAATGAAGAACTCAGGAGAGAGG + Intergenic
1085910151 11:80814657-80814679 CAATGATTAAATCAGAAAAGTGG + Intergenic
1089052409 11:115557236-115557258 TAATTAGAAAAGGAGGAAAGGGG + Intergenic
1089410054 11:118233399-118233421 CTCTTAGGTAAGCAGGAAAGTGG + Intronic
1089907928 11:122064421-122064443 CAATGAGAAAATCAGGAGAAAGG - Intergenic
1090325307 11:125881131-125881153 ATATTAGAAACTCAGGAAAGAGG + Intergenic
1090537148 11:127655564-127655586 GAATTAGGACAATAGGAAAGAGG + Intergenic
1091475443 12:767825-767847 CAATTAGGAAGGGAGGTAAGAGG - Intronic
1091691379 12:2599684-2599706 GAATTAGGAAAGCAGGACCGAGG + Intronic
1093652361 12:21659815-21659837 AAATTAGGAATCCAAGAAAGGGG + Intronic
1096040359 12:48509931-48509953 GAATTAGGAAAAAATGAAAGTGG + Intronic
1098366890 12:69712810-69712832 CAATTAAGAAATACTGAAAGGGG + Intergenic
1098963436 12:76762798-76762820 CAATTTGTAAATCAGGAGGGAGG - Intergenic
1099115325 12:78617360-78617382 CAAGTAACAAACCAGGAAAGAGG + Intergenic
1099360668 12:81695953-81695975 CAATCAGAAAATCAGCAAAAAGG + Intronic
1099906392 12:88776342-88776364 CAAATATGAAATAAGGGAAGGGG - Intergenic
1106535734 13:30641182-30641204 GAATTAGGATCTCAGGGAAGGGG + Intronic
1106754960 13:32813539-32813561 CACTGAGGAAATCAGGGTAGGGG - Intergenic
1106822936 13:33486602-33486624 CAATAAGGAAAGATGGAAAGAGG - Intergenic
1107300165 13:38957870-38957892 CTATTAGGAAAGCAGAAATGTGG + Intergenic
1107831600 13:44379025-44379047 AAATTAGGAAGTCAGTACAGTGG - Intronic
1108192597 13:47957519-47957541 TAATGAGGCAATCAGGAATGTGG - Intronic
1108443208 13:50477523-50477545 CAGTATGGAAATGAGGAAAGGGG + Intronic
1109428844 13:62205316-62205338 CAGTTAGGAAAACAGGAATTAGG + Intergenic
1109729773 13:66396836-66396858 GAATTTGGAAGTCAGAAAAGAGG + Intronic
1109807546 13:67463797-67463819 AAATCAGGAAATCATGAAAAAGG - Intergenic
1112647343 13:101349742-101349764 GAATTGAGAAATCATGAAAGTGG - Intronic
1112667021 13:101586407-101586429 GAATGAGGAATTGAGGAAAGAGG + Intronic
1112714673 13:102170032-102170054 CAGTGAGGAAGACAGGAAAGGGG + Intronic
1114422064 14:22592526-22592548 CTATTAGGAAACAAGGAGAGGGG - Intergenic
1114499401 14:23156903-23156925 CACTATGGGAATCAGGAAAGAGG + Intronic
1114869393 14:26637938-26637960 CAGTTAGGAAATCAATCAAGAGG - Intergenic
1115204741 14:30890014-30890036 CTCTTAGAAACTCAGGAAAGAGG + Exonic
1115423452 14:33225050-33225072 CAGTTAGAAAGGCAGGAAAGTGG - Intronic
1116442708 14:44972074-44972096 CTATTATGAGAACAGGAAAGGGG + Intronic
1117896105 14:60488699-60488721 CAATTAGGAAATGAGTGGAGAGG - Intronic
1117973726 14:61277898-61277920 CTATTAAGAAATTAGCAAAGTGG + Exonic
1118346123 14:64942497-64942519 CAATTTGGACATCAGGTGAGGGG - Exonic
1119790456 14:77345285-77345307 CATTTAAGAAATGAGGAAACTGG - Intronic
1124960723 15:34391868-34391890 CACTTTTGAAATCAGGAAACAGG + Intronic
1124977352 15:34538089-34538111 CACTTTTGAAATCAGGAAACAGG + Intronic
1126314811 15:47358609-47358631 CATTTCAGAAACCAGGAAAGTGG - Intronic
1126694536 15:51314857-51314879 GAAGTAGGAAATGAGGAAAATGG - Intronic
1126738807 15:51757525-51757547 CAGTTAGGAAAACAGAAAATAGG - Intronic
1127669066 15:61177266-61177288 CAATTAGAAAAACAGGTGAGTGG + Intronic
1128389571 15:67173991-67174013 CAGTTGGAAAGTCAGGAAAGCGG + Intronic
1128574538 15:68763195-68763217 CAATTAGAAAATCAACAAATGGG + Intergenic
1130029351 15:80297684-80297706 AAGTTAGGAATTCAGAAAAGGGG + Intergenic
1131967254 15:97857593-97857615 AAATCTGGAATTCAGGAAAGTGG + Intergenic
1132134112 15:99316454-99316476 GAATTAGGGAATAAGGAAATAGG + Intronic
1134179130 16:12033404-12033426 CAATTATGAAAACAGAAAAAAGG - Intronic
1135305866 16:21367177-21367199 CAATTATGAAAACAGAAAAAAGG - Intergenic
1135784775 16:25339091-25339113 CAAGTAGAAATTCAGGAAAAAGG - Intergenic
1136302608 16:29346328-29346350 CAATTATGAAAACAGAAAAAAGG - Intergenic
1136379471 16:29885804-29885826 AAGTTAGGAAAGCAGGCAAGGGG - Intronic
1137695772 16:50461052-50461074 AAATCAGGAAAACAGGACAGGGG - Intergenic
1138224487 16:55281000-55281022 CTCTTAGGAAATGAGGAAGGGGG + Intergenic
1138312841 16:56042788-56042810 TAAATTAGAAATCAGGAAAGAGG + Intergenic
1138844254 16:60546001-60546023 AAATTAAGAAATCTGGAGAGAGG + Intergenic
1139116163 16:63956181-63956203 CATTTAGGAAATGAGGAATAGGG - Intergenic
1139149335 16:64361700-64361722 CAATTACAAAGTCAGGAGAGAGG + Intergenic
1139197799 16:64941291-64941313 CACTAAGCAAATCATGAAAGTGG - Intergenic
1139226170 16:65234878-65234900 AAATTTGGTAATCAGGTAAGCGG - Intergenic
1140347608 16:74229074-74229096 CATTGATGAAATCAAGAAAGTGG + Intergenic
1141686922 16:85575496-85575518 CAAGGAGGAGATCAGAAAAGAGG - Intergenic
1142329832 16:89444698-89444720 CACTTTGGAAAACAGGAAGGAGG + Intronic
1142644416 17:1302737-1302759 CAATCAGTAAACGAGGAAAGGGG + Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1146829778 17:36058487-36058509 CAATTATCTTATCAGGAAAGTGG + Intergenic
1146992091 17:37283734-37283756 ATATTATGAAATCAGGAATGGGG + Intronic
1148235154 17:45963900-45963922 GAATTTGGGAATTAGGAAAGTGG + Intronic
1148725891 17:49789453-49789475 GAACTAGCAAATAAGGAAAGAGG - Intronic
1149283452 17:55133431-55133453 CAGTTTGGAAATCAGGAGAGAGG + Intronic
1150854862 17:68742600-68742622 TAAGTAGGAAGTCAGGAATGGGG - Intergenic
1153364828 18:4243740-4243762 TAATTTTGAAATAAGGAAAGTGG + Intronic
1153910480 18:9702128-9702150 AAAATAGGAAATAAGAAAAGAGG - Intergenic
1153951343 18:10060260-10060282 CCATTTGGAAATGAGGAAATGGG - Intergenic
1156272440 18:35548439-35548461 CAAAGAGAAAATCTGGAAAGTGG + Intergenic
1156411341 18:36830436-36830458 GAATTAGGAAGTTAGGAAATTGG + Intronic
1158109471 18:53924696-53924718 CAATAATGAAAACCGGAAAGCGG + Intergenic
1159050630 18:63418248-63418270 GAAATAGGAGATCAGGAAACTGG - Intronic
1159449599 18:68583494-68583516 CAATTATAAGATGAGGAAAGTGG - Intergenic
1159801488 18:72905953-72905975 CAATTTGGAAATCAGAGGAGAGG - Intergenic
1159976773 18:74722904-74722926 CAAGTAGAAAAACAGAAAAGGGG - Intronic
1160700993 19:507345-507367 CAATAAGGACACAAGGAAAGTGG + Exonic
1164034385 19:21440167-21440189 CAATTAGGAACACAGGAACTGGG - Intronic
1166284751 19:41817931-41817953 CAATTAGAAAATGTGAAAAGAGG - Intergenic
1166379801 19:42350006-42350028 GATTTAGGAAATCAGTAAAGAGG - Intronic
1167088084 19:47324209-47324231 CAGCCAGGAAATCAGGGAAGGGG - Intergenic
925680510 2:6416058-6416080 AAATTAGGATATCAGAAATGTGG - Intergenic
925960324 2:9008242-9008264 CAATTAGGAAATCACAAAGTAGG + Intergenic
926181564 2:10649006-10649028 CAATTAGGAAAACCTGAAAATGG + Intronic
926494728 2:13571990-13572012 CAATGAGGAAACCAGGATATGGG - Intergenic
927067932 2:19492756-19492778 GACTTAAGAAAGCAGGAAAGTGG + Intergenic
927259920 2:21078064-21078086 CAATAAAGAATTCAGGAAAGGGG - Intergenic
927900599 2:26815703-26815725 CAATCAGGAAAGTAGAAAAGTGG - Intergenic
928073444 2:28240948-28240970 CAATTAGGAAATTTTGAAAATGG + Intronic
928349495 2:30535937-30535959 CAATGAGAAATTCAGGAAAATGG + Intronic
928643716 2:33328329-33328351 CAATAATGAAGTCAGGATAGTGG - Intronic
929400413 2:41573967-41573989 CATTTAGGAAAGGAGGAAACTGG - Intergenic
929687533 2:44047477-44047499 CAAGAAGGAAATCAGGGAAAGGG + Intergenic
931106872 2:59066461-59066483 AAATTAGGAAATGAGGAAAAAGG - Intergenic
931915133 2:66946203-66946225 CAATTAAAAAAGCAGGAAAGAGG + Intergenic
932159632 2:69448234-69448256 CCCTTAGGAAAGCAGAAAAGGGG + Intergenic
933199209 2:79429650-79429672 ATATTAGGAAACCATGAAAGTGG + Intronic
933940598 2:87241808-87241830 AAACTTGGAAATAAGGAAAGAGG + Intergenic
933975499 2:87506137-87506159 CAATCAGGAAGGCAGGAATGTGG + Intergenic
934749472 2:96783578-96783600 CAATTAGGAAATCAGGCATCAGG - Intronic
935154635 2:100472498-100472520 CTATTAGCAAGTCAGCAAAGAGG - Intronic
935873651 2:107481754-107481776 GAATTAAGAAATCAGAAAAGGGG - Intergenic
936318327 2:111444676-111444698 CAATCAGGAAGGCAGGAATGTGG - Intergenic
936352538 2:111723968-111723990 AAACTTGGAAATAAGGAAAGAGG - Intergenic
936673354 2:114685082-114685104 AAATGAGGATATCTGGAAAGAGG - Intronic
936677514 2:114732245-114732267 CAGTTAAGAAAACAGGAAACTGG + Intronic
936686048 2:114827581-114827603 CAATTAATAAATCAAAAAAGTGG - Intronic
937199690 2:120192374-120192396 CAAATAGGAATTCCAGAAAGAGG + Intergenic
937946488 2:127343147-127343169 CAATTTGAAAATTAGGAAAATGG + Exonic
938259549 2:129885395-129885417 CAATTAAGAACTCAGGTTAGAGG - Intergenic
938631643 2:133173916-133173938 ACATTTGGAAATCAGGAGAGGGG + Intronic
938990078 2:136618888-136618910 CAAGTAGTAAATAAAGAAAGAGG - Intergenic
939103939 2:137927693-137927715 GAATTAGTAAAAAAGGAAAGAGG + Intergenic
939526292 2:143298890-143298912 CAATTATGATATCTGTAAAGTGG - Intronic
940118004 2:150231272-150231294 CCACTAGGAAATCAGGTAAAAGG + Intergenic
941175835 2:162196238-162196260 TAATTTGGAAATGAGGAAAAAGG + Intronic
941222316 2:162798167-162798189 TACTAAGGAAAACAGGAAAGTGG - Intronic
941447761 2:165623763-165623785 GAAGTAGGAATTCAGGAAGGAGG - Intronic
941577471 2:167251166-167251188 TCAAGAGGAAATCAGGAAAGTGG + Exonic
941706870 2:168668151-168668173 CAAGAAGAAAATCAGAAAAGAGG - Intronic
942106898 2:172642339-172642361 CAATTATGTAATTAGGAAGGTGG + Intergenic
943492907 2:188579309-188579331 AAGTTAGGAAATCTAGAAAGTGG - Intronic
944044531 2:195393675-195393697 TATTTAGGAAGTCAGGAAATTGG - Intergenic
946088996 2:217203912-217203934 CAAAGAGAAAATTAGGAAAGTGG - Intergenic
947697661 2:232205615-232205637 AAATTAGGAAATGAGGTAAAAGG + Intronic
948391577 2:237615217-237615239 CAATTTAGAAACCAGGCAAGTGG + Intergenic
948570040 2:238912293-238912315 CAACTTGGAAACCAAGAAAGAGG - Intergenic
1169260662 20:4135910-4135932 CAATAAGTGGATCAGGAAAGAGG + Intronic
1169413859 20:5398939-5398961 CAATGAGCAAAACAGGAAAGTGG + Intergenic
1169478733 20:5957310-5957332 AAATGAGGAAATCAGTAAAAAGG + Intronic
1169534423 20:6522757-6522779 CAATTTTGAGTTCAGGAAAGAGG - Intergenic
1170516558 20:17136318-17136340 CAAGTAGGTAACCAGGAGAGTGG + Intergenic
1171241114 20:23567710-23567732 GAAGTTGGAAATCAGCAAAGAGG + Intronic
1172171392 20:32935800-32935822 CAATTAGAAAATGAGCAAAGTGG - Intronic
1173008031 20:39156111-39156133 CAATTAGCAAATTAGGTTAGCGG + Intergenic
1173535344 20:43806520-43806542 AAATTACTAAATCAGGAAAGAGG - Intergenic
1173547745 20:43912031-43912053 AGATCAGGAAATCAGGAATGGGG + Intergenic
1173665467 20:44759913-44759935 GTAGTAGGAAATCAGGAAAAGGG - Intronic
1174681290 20:52411218-52411240 CAATTAGGAGCCCAGGAAACAGG - Intergenic
1175018036 20:55812923-55812945 CAAATAGGCAATGAGGAAAGAGG + Intergenic
1175195091 20:57237578-57237600 AAATTGGGAATTCTGGAAAGTGG + Intronic
1176104295 20:63378541-63378563 GCATTAGGAAATAAGGAACGGGG + Intergenic
1178961592 21:37071657-37071679 CTGTTTGGAAACCAGGAAAGTGG - Intronic
1179267902 21:39821315-39821337 CAATGAGGAAATGAAGAAACTGG - Intergenic
1181266554 22:21634162-21634184 CAGTTAGGAAATCCAGAAAGTGG - Exonic
1181278496 22:21702426-21702448 TGATCAGGAATTCAGGAAAGAGG + Intronic
1185142547 22:49111053-49111075 CAATTAGGAAATGTTGAAAGTGG + Intergenic
949211681 3:1510591-1510613 AAATTAGGAGCTCAGGAAAATGG - Intergenic
949748060 3:7318248-7318270 CATTTAGGAAAGCAGGAACTTGG + Intronic
950728712 3:14937279-14937301 CAATTTGGAAATCAGTTAAAAGG + Intergenic
951055965 3:18146627-18146649 CAGTTTGGAAATAAGGGAAGGGG - Intronic
951897538 3:27624529-27624551 GAATCAGGAATTCAGGAGAGAGG + Intergenic
952172931 3:30829352-30829374 CAATCAGGAAATCAGCATTGTGG + Intronic
952374966 3:32759342-32759364 CAATCTGGACACCAGGAAAGAGG - Intronic
952461973 3:33536966-33536988 GAATGTGGAACTCAGGAAAGAGG + Intronic
952791349 3:37203114-37203136 CTATTAGGACTTCTGGAAAGTGG + Intergenic
953494481 3:43374194-43374216 CAATTAGAAATGCAGGAAATGGG - Intronic
953637501 3:44675639-44675661 CTATAAGGAACTCAGGAAAGAGG + Intergenic
953775312 3:45811798-45811820 CAAAAAGGAAGTCAGGAGAGTGG + Intergenic
953778971 3:45849171-45849193 CTTTTAGGAAACCAGGCAAGGGG + Intronic
954071858 3:48148840-48148862 CACTTAGGAAACCATGAAATAGG - Intergenic
954362834 3:50131347-50131369 CATGCAGGAAATCAGCAAAGAGG - Intergenic
954390238 3:50264814-50264836 CAATGAGGAAAACAGGAGTGAGG + Intergenic
956165392 3:66394642-66394664 CAAGTAGTTTATCAGGAAAGTGG - Intronic
957409669 3:79823007-79823029 CAATTTGTAAATGAGGAAGGAGG - Intergenic
958777298 3:98501413-98501435 CAAGTAGGAGAAGAGGAAAGAGG - Intronic
959598986 3:108157889-108157911 CATTTAGGAAACCATGAAATTGG + Intergenic
959622052 3:108409269-108409291 CAAGAAGAAAATCAGGGAAGAGG + Intronic
959749544 3:109817264-109817286 CAATTAGGTAATGTGAAAAGAGG + Intergenic
960074205 3:113465205-113465227 CAATTAGTCAAGCAGCAAAGAGG + Intronic
960239320 3:115321982-115322004 CAATTAGAAAAGAAGGAAAATGG + Intergenic
960513724 3:118580074-118580096 CAATTCTGAAAACAGCAAAGAGG - Intergenic
961049452 3:123734173-123734195 CAATTCAGATGTCAGGAAAGAGG - Exonic
961323593 3:126096343-126096365 CAATTTGCAAATCAAAAAAGGGG + Intronic
961851365 3:129822575-129822597 CAAGCAGGAAATAAGAAAAGGGG - Intronic
963121902 3:141783569-141783591 CAATTAGGAAATCAGTGTAAGGG + Intronic
963670993 3:148252150-148252172 AACTTAGGAAATAAGGCAAGAGG + Intergenic
964590294 3:158354429-158354451 CAGTTAGGAAAGCAGAAAAGTGG + Intronic
965208766 3:165757285-165757307 GAAATAAGAATTCAGGAAAGAGG - Intergenic
965516523 3:169627828-169627850 CAATTAGGAAATCAGGAAAGAGG + Intronic
966940756 3:184745444-184745466 CAAGTAGGAAATCATAAAATAGG - Intergenic
970338132 4:15074450-15074472 AAATTATAAAATCAGAAAAGCGG + Intergenic
970502032 4:16687751-16687773 CAAAAAGGAGATCAGGAAAAAGG + Intronic
971532179 4:27703178-27703200 CAAATGGGAAATCAGAAAAGGGG - Intergenic
972037368 4:34543102-34543124 CAAATAGGAAATAAAGAAAATGG + Intergenic
975383818 4:73732122-73732144 TCATGAGGAAATCAGGCAAGAGG + Intergenic
975589763 4:75988291-75988313 CAAATAGGGAATGAGGAAAGGGG - Intronic
975931594 4:79530523-79530545 GAATCAGTAACTCAGGAAAGGGG + Intergenic
976031924 4:80765890-80765912 AAACTTGTAAATCAGGAAAGAGG + Intronic
976152638 4:82107516-82107538 CGATTGGGAAAGCAGGAAGGAGG + Intergenic
976929665 4:90550092-90550114 GAATTTGGAAAGCAGGGAAGGGG + Intronic
978990620 4:115077656-115077678 AAATTAGGAAATCAGGAATCAGG + Intronic
979399927 4:120236887-120236909 GAATCAGGTAAGCAGGAAAGAGG + Intergenic
979419121 4:120481417-120481439 GTATAAGGAAATCAGGAAACAGG + Intergenic
979940366 4:126754553-126754575 GAATTAGAAATTCAGGAGAGGGG - Intergenic
979947472 4:126851155-126851177 CAATTAGTGAGTCAGGAAAAGGG - Intergenic
980005562 4:127538451-127538473 CAATTAAAAAATGAGCAAAGGGG + Intergenic
980176852 4:129356306-129356328 CAAGAAGGAAAAAAGGAAAGAGG - Intergenic
980484401 4:133436755-133436777 GAATTAGAAAATAAGGAAATGGG - Intergenic
980763838 4:137272336-137272358 CAATTTGGAAAACAGTACAGAGG + Intergenic
981603751 4:146521467-146521489 AAATTAGAAAATCAGCAAAAGGG + Intronic
982199638 4:152947763-152947785 CATCTAGGAAATAAGTAAAGTGG + Intronic
982366341 4:154583854-154583876 CATTCAGTACATCAGGAAAGTGG - Exonic
982523829 4:156452962-156452984 AAATAAGGAAATAAAGAAAGAGG - Intergenic
983278755 4:165653257-165653279 CACTTAGGACATCATGCAAGTGG - Intergenic
983562840 4:169118158-169118180 CAAGTAGGAAGCCAGGAAACAGG - Intronic
983639147 4:169928398-169928420 AGATAAGGAAATCAGGAGAGAGG + Intergenic
984022225 4:174499551-174499573 CAAATAGGAGGTCAAGAAAGTGG - Intronic
984187201 4:176560311-176560333 CAATTCTGAAATTAAGAAAGTGG + Intergenic
985313894 4:188633480-188633502 CAATTAAGAAATAAGGAAAATGG + Intergenic
985670660 5:1204966-1204988 AAAGTAGGAAACCAGGAGAGAGG - Intronic
986894734 5:12351625-12351647 AAATTAGGAACTCAAGAAATAGG - Intergenic
987011541 5:13770921-13770943 CAGTTTGGAAATCAAGAAGGAGG - Exonic
989526286 5:42456976-42456998 CAAATAAGAAATAATGAAAGAGG - Intronic
989735000 5:44693516-44693538 AAATTGGGAAATGAGAAAAGGGG - Intergenic
991071077 5:62481216-62481238 CAATTAGGAAAAGAGGAAGTCGG - Intronic
991365000 5:65859289-65859311 CAAATAGCAAATCTGGACAGAGG + Intronic
991511574 5:67383001-67383023 CAGATGGGAAATGAGGAAAGAGG - Intergenic
993823777 5:92655381-92655403 AAATGAGCAAATTAGGAAAGAGG - Intergenic
993960200 5:94288301-94288323 TAATTAGGAAATCAGAGATGGGG - Intronic
994295803 5:98086444-98086466 CAATGAAGAGATCAGGGAAGGGG + Intergenic
994582548 5:101663705-101663727 CATTTATGAAGTCAGGAAAAGGG + Intergenic
994610869 5:102037576-102037598 TAATTTGGAAATAAGAAAAGTGG + Intergenic
994914903 5:105962758-105962780 GCATAAAGAAATCAGGAAAGAGG - Intergenic
995411581 5:111863413-111863435 AGATTTGGAAATCAGAAAAGAGG + Intronic
995642177 5:114269340-114269362 CAGTTTGGAAGTTAGGAAAGGGG - Intergenic
996204826 5:120720156-120720178 CATTTAGCAAGTCAGGAGAGAGG - Intergenic
996537657 5:124594984-124595006 CAAATAGGAAATCAGAACAGGGG - Intergenic
998440857 5:142160967-142160989 CATTTAGGAAAGAAGGAATGAGG - Intergenic
998638305 5:143981711-143981733 CAAGTAGGATATGAGGAGAGTGG - Intergenic
999175337 5:149628033-149628055 CAATTAAAAAATTAAGAAAGCGG + Intronic
999366479 5:151026965-151026987 CAATTTGGAAAACAGGAACCAGG + Exonic
1000168024 5:158673868-158673890 GAATTAGGAAATCAGAAGAAAGG + Intergenic
1001363918 5:171117791-171117813 CAATTAGAAAATGGGCAAAGAGG - Intronic
1003444554 6:6172747-6172769 CAATTAAGAAATCACTATAGTGG - Intronic
1003467446 6:6394347-6394369 GCATTAGGAAATCAGGAGAATGG - Intergenic
1003515111 6:6811409-6811431 CTATTAGGAAAACAAGGAAGAGG + Intergenic
1003942957 6:11045849-11045871 AAATTCGTAAATCAGGAAACTGG - Intergenic
1004811421 6:19268471-19268493 AAATTAGGACTTCAGGAAGGTGG + Intergenic
1005810297 6:29510078-29510100 CATTTAGCAAAGCAGGAAACAGG + Intergenic
1006438404 6:34038866-34038888 CAGTTAGGACATCTGGAAAATGG + Intronic
1008191022 6:48457354-48457376 TAATTAGGAAATCACTAAAGTGG + Intergenic
1008211919 6:48735880-48735902 CAGAGAGGAGATCAGGAAAGAGG + Intergenic
1008646344 6:53518732-53518754 CACTTAGCAAATTAAGAAAGTGG - Intronic
1009549925 6:65076954-65076976 GAATTAGGAAATCAGAAAACAGG + Intronic
1009701317 6:67185647-67185669 CAAATAGGAAAAGAGGAAGGAGG - Intergenic
1010181118 6:73087492-73087514 GAATTGGGAACTCAGAAAAGTGG + Intronic
1010746189 6:79564580-79564602 TAATTTGGAAAAAAGGAAAGAGG - Intergenic
1010760863 6:79721394-79721416 AAAGCAGGAAATCAGGAAAATGG - Intergenic
1012201586 6:96412581-96412603 AAATTAGGTAATCAGGCAAATGG - Intergenic
1012227550 6:96722097-96722119 CAAAAAGTAGATCAGGAAAGAGG + Intergenic
1013042408 6:106448732-106448754 CAATTAGGAAAAAAGGAGAAGGG - Intergenic
1014620359 6:123660161-123660183 CACTTAGGGAATAAGGAAAAAGG - Intergenic
1015272412 6:131350713-131350735 CAATAATGATATCAAGAAAGAGG - Intergenic
1017306053 6:152919623-152919645 AAGTTAGTAAATCAGGAAACAGG + Intergenic
1017429526 6:154357171-154357193 CGATTAGGAAAGGAGGAAAGAGG - Intronic
1018627840 6:165796885-165796907 CAATCAGTAAATCCAGAAAGTGG - Intronic
1018978257 6:168582041-168582063 TAATGAAGAAATCAGGAAACGGG - Intronic
1019956297 7:4417271-4417293 CAGTTAGGACATCAGTGAAGTGG - Intergenic
1020358714 7:7304377-7304399 CAGTTTGGAAATCAGAGAAGTGG - Intergenic
1021024655 7:15649841-15649863 CCATCAGGAACTCAGGACAGGGG + Intronic
1021157577 7:17230731-17230753 AAATTAGGAAAAGAGGGAAGAGG + Intergenic
1021674596 7:23067632-23067654 CAAGAAGGAAAACAGGAAACAGG + Intergenic
1022339536 7:29455489-29455511 TAAATAGGAAGTCAGGAAACCGG - Intronic
1022354247 7:29597458-29597480 GAATTAGTAATTCAGTAAAGTGG - Intergenic
1023164211 7:37327072-37327094 CAATATGGGAATTAGGAAAGTGG - Intronic
1023542501 7:41280748-41280770 CTATGAGGAAGTAAGGAAAGCGG - Intergenic
1023554230 7:41403499-41403521 CTCTTAGGAATTCAGGAAAAGGG + Intergenic
1024421159 7:49168332-49168354 AATTTATGAAATAAGGAAAGAGG + Intergenic
1025103589 7:56152912-56152934 CAATTTGGAAATCAAAGAAGGGG + Intergenic
1026403248 7:70038027-70038049 AAACTAGGAAAGCAGGAATGAGG + Intronic
1027749001 7:82117388-82117410 CATTGAGGAAATCAGGAGAGTGG - Intronic
1027779250 7:82502386-82502408 CAGTTAGGAAAGCAGGAATTAGG + Intergenic
1029406363 7:100376320-100376342 CAAGCAGGAATTAAGGAAAGAGG - Intronic
1030201016 7:106904060-106904082 GAAGTATGAAATCAGAAAAGTGG - Intronic
1032557640 7:132854042-132854064 CAATGAGTAAATGAGGAAATGGG + Intronic
1033188077 7:139248276-139248298 AAATTTGGAAATCATGGAAGAGG + Intronic
1033261116 7:139844909-139844931 CAATGAGGAAATGAGCAAGGAGG - Intronic
1033363757 7:140656060-140656082 CAATTAGGAACACAGGAACTGGG + Intronic
1033387464 7:140892329-140892351 CAATTATGAAATCCCAAAAGGGG + Intronic
1034022601 7:147661499-147661521 GAATTTGGAAATCAGAACAGAGG - Intronic
1034240217 7:149604623-149604645 CAACTAGGAAATGCAGAAAGAGG - Intergenic
1035775442 8:2184034-2184056 GAATCAGGGAGTCAGGAAAGGGG - Intergenic
1036622225 8:10431818-10431840 CACTTAGGAAAGCTGGAGAGCGG - Intergenic
1036974785 8:13398462-13398484 CAATAATTAAATCAAGAAAGAGG + Intronic
1037324284 8:17673090-17673112 GAGTTAGAAGATCAGGAAAGAGG - Intronic
1037476051 8:19258753-19258775 AAATAAGGAAAACAGGCAAGAGG + Intergenic
1037708944 8:21340130-21340152 CAATTGGAAAAACATGAAAGGGG + Intergenic
1038755192 8:30334112-30334134 CAATTTGAAAATAAGGAAAGCGG + Intergenic
1040512561 8:48107930-48107952 GAATTAGAAAAGCAGGAAAAAGG - Intergenic
1042148949 8:65760912-65760934 CATTTAGGAATACAGGAGAGAGG + Intronic
1042384850 8:68162506-68162528 GAATTAGGAAATTATGAAACAGG + Intronic
1043784637 8:84383283-84383305 CAAATAGGTATTCAGAAAAGAGG + Intronic
1044722912 8:95168122-95168144 AAAGTAGGAGAGCAGGAAAGAGG - Intergenic
1045064714 8:98435123-98435145 CAATGAGGACACGAGGAAAGAGG + Intronic
1045194669 8:99918347-99918369 CAATTTGCAAATGAGCAAAGGGG + Intergenic
1046302654 8:112317716-112317738 CAAAAAGAAAAGCAGGAAAGTGG - Intronic
1046590253 8:116197810-116197832 AAATTAAGAAATAAAGAAAGAGG - Intergenic
1050105422 9:2161129-2161151 CAATTAGTAAACAAGGAAACGGG - Intronic
1051261772 9:15271816-15271838 CAATTAGGAAACCAGTGAAATGG - Intronic
1052500453 9:29282441-29282463 CAATTAGTAAATCAGGACTTAGG - Intergenic
1052511993 9:29434199-29434221 AAATTAGGGAATGTGGAAAGAGG + Intergenic
1052693395 9:31845605-31845627 GAATTATCAAATCAGGAAACAGG - Intergenic
1053287931 9:36861894-36861916 CAATGGGGAGACCAGGAAAGAGG + Intronic
1055149366 9:72977000-72977022 CAATGTGGAAATATGGAAAGTGG - Intronic
1055279176 9:74654938-74654960 CAAATAGAAAATGAGGAATGTGG + Intronic
1055977622 9:81970168-81970190 CAATAAGGAAAACAGAAATGTGG + Intergenic
1057586795 9:96335636-96335658 CAACTAGGAAATCATTAAAAAGG - Intronic
1058367756 9:104230751-104230773 AAATTAAAAAATCAGTAAAGAGG + Intergenic
1058474355 9:105316728-105316750 CTGTTAGGAACTCAGGAAAGTGG - Intronic
1059032740 9:110717257-110717279 CAATTTCAAAATCAGCAAAGTGG - Intronic
1059232311 9:112732341-112732363 GAATAAGGAAAACAGGAAAATGG - Intergenic
1059237027 9:112769771-112769793 GAATTTGGAATTCAGGAGAGAGG - Intronic
1059332443 9:113544134-113544156 CAATTAGCCCATCAGGAAAGAGG - Intronic
1060289046 9:122283417-122283439 CCATTTAGAAATCAGGAAACAGG + Intronic
1060429344 9:123535930-123535952 AAATTGGGAAAACAGAAAAGGGG + Intronic
1061556108 9:131370315-131370337 CACTTAAGAAATGAGGAAACTGG - Intergenic
1062697619 9:137883596-137883618 CAGTCAGGGAAGCAGGAAAGGGG - Intronic
1187350813 X:18515228-18515250 CAATTAGAACTTGAGGAAAGTGG + Intronic
1187985426 X:24805335-24805357 GAATTAAGAAGTCAGGAAATCGG + Intronic
1188901841 X:35742480-35742502 CAAATAGGAAAAGATGAAAGTGG + Intergenic
1190109181 X:47578879-47578901 CATTTGGGAAATGAGGAAGGGGG - Intronic
1190576435 X:51844158-51844180 CAATTTGGGAACCTGGAAAGGGG - Intronic
1192801211 X:74466282-74466304 TAAGTAGGGAGTCAGGAAAGGGG - Intronic
1193777892 X:85666157-85666179 CACTTAAAAAATCAAGAAAGAGG - Intergenic
1194629720 X:96269061-96269083 CAAATTGGAAAAGAGGAAAGCGG + Intergenic
1195657506 X:107346094-107346116 CATTGAGGAAATCAGGCCAGTGG + Intergenic
1196493407 X:116294810-116294832 CAATGATGATATCAGCAAAGTGG + Intergenic
1197690871 X:129500006-129500028 CCATTAGAAAATCAGAATAGGGG + Intronic
1198145959 X:133858097-133858119 CAATGGGAAACTCAGGAAAGGGG + Intronic
1198491915 X:137150091-137150113 CAAATAGGAAAGCAGGGAAAGGG - Intergenic
1198526219 X:137503685-137503707 CAGTCAGGAAAACAGTAAAGTGG - Intergenic
1198834675 X:140791632-140791654 CTAATATCAAATCAGGAAAGGGG - Intergenic