ID: 965517223

View in Genome Browser
Species Human (GRCh38)
Location 3:169634500-169634522
Sequence TCACCCTTACCAACAAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965517223_965517229 5 Left 965517223 3:169634500-169634522 CCAAGGCTTGTTGGTAAGGGTGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 965517229 3:169634528-169634550 GGCAAATAGCAGAGGGCAGAAGG 0: 1
1: 1
2: 7
3: 51
4: 462
965517223_965517227 -3 Left 965517223 3:169634500-169634522 CCAAGGCTTGTTGGTAAGGGTGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 965517227 3:169634520-169634542 TGAAGAGGGGCAAATAGCAGAGG 0: 1
1: 0
2: 5
3: 33
4: 271
965517223_965517230 6 Left 965517223 3:169634500-169634522 CCAAGGCTTGTTGGTAAGGGTGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 965517230 3:169634529-169634551 GCAAATAGCAGAGGGCAGAAGGG 0: 1
1: 0
2: 1
3: 45
4: 480
965517223_965517228 -2 Left 965517223 3:169634500-169634522 CCAAGGCTTGTTGGTAAGGGTGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 965517228 3:169634521-169634543 GAAGAGGGGCAAATAGCAGAGGG 0: 1
1: 0
2: 1
3: 24
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965517223 Original CRISPR TCACCCTTACCAACAAGCCT TGG (reversed) Intronic
900608345 1:3533782-3533804 TCACCCTCACCAACAGGCGACGG + Intronic
905603290 1:39272613-39272635 TCACTCTCATCAACAAGCCCTGG - Intronic
909507145 1:76405515-76405537 TCATCCTTACCAACCACCCTGGG - Intronic
910596391 1:88985252-88985274 TCACCCATATCAATAGGCCTGGG + Intronic
911254159 1:95614909-95614931 TCCCCCTTCCCCACAAGCCAGGG - Intergenic
916279251 1:163030584-163030606 TCAACCTTACAAACAAGACTTGG + Intergenic
918696661 1:187553576-187553598 TCACCCTCTCCAGAAAGCCTTGG + Intergenic
918924021 1:190756657-190756679 ACACCCTTACAAACATGCCCAGG - Intergenic
919693117 1:200545061-200545083 TCACCCAGACCAAAAATCCTAGG - Intergenic
922185564 1:223271296-223271318 TCACTCTTAGAAACAAGGCTTGG - Intronic
1064811216 10:19200524-19200546 TATTCCTTACCAACAAACCTCGG + Intronic
1071561609 10:86650224-86650246 TCAGGCCTACCCACAAGCCTGGG - Intergenic
1072513984 10:96159147-96159169 TGAACATTACTAACAAGCCTGGG + Exonic
1073290728 10:102412019-102412041 TCACCCTTCCCAAGATGGCTGGG - Intronic
1073607638 10:104912404-104912426 TCACCCTGAGCAACTATCCTAGG - Intronic
1078451671 11:11445005-11445027 TGAGCCTTGGCAACAAGCCTTGG + Intronic
1083061095 11:59873338-59873360 TCACCCTTGCACTCAAGCCTAGG - Intergenic
1084410780 11:69004972-69004994 TCTCTTTTACCAACCAGCCTAGG + Exonic
1089060952 11:115625751-115625773 TCACCCTCCCCATTAAGCCTGGG - Intergenic
1091194151 11:133717738-133717760 TCAGCCCTTACAACAAGCCTGGG + Intergenic
1095525416 12:43119234-43119256 TCACCCTCACCAACATGTGTAGG - Intergenic
1096485410 12:51977050-51977072 TCACCCCCACCAAAAACCCTTGG - Intronic
1097314405 12:58156365-58156387 TCACCCTCACCAATGAGGCTGGG - Intergenic
1100483972 12:95007042-95007064 TCACCCTTATCACCAAAGCTGGG + Intergenic
1105607017 13:21934408-21934430 TCTCCCTCTCCACCAAGCCTGGG + Intergenic
1113697801 13:112359566-112359588 CCACTGTTACCAACAGGCCTGGG - Intergenic
1118762455 14:68888898-68888920 TCCCCGGTACCAACAAGGCTGGG + Intronic
1120831455 14:89000942-89000964 CCACCCTTACCCACAAACATGGG + Intergenic
1125413624 15:39430185-39430207 TGACCCTGATCAACAAGCTTTGG - Intergenic
1128786855 15:70403980-70404002 TCACCCTGACCACCTGGCCTGGG - Intergenic
1129670450 15:77605083-77605105 TCATCCTAAAGAACAAGCCTTGG + Intergenic
1130801481 15:87268013-87268035 TCATCCTTCCCCACAGGCCTTGG - Intergenic
1130882177 15:88064821-88064843 TCACCCTTACCCACATGCAATGG + Intronic
1132277800 15:100584476-100584498 TCACTCTTACCAAAGAACCTGGG - Intronic
1133095851 16:3444752-3444774 TCAACGTTACCAACATGCTTAGG - Intronic
1134176484 16:12011041-12011063 TCATCCTGACCAAAAATCCTGGG + Intronic
1135922978 16:26667818-26667840 GCACCCTTACCCTCCAGCCTGGG - Intergenic
1140035442 16:71368010-71368032 TCATCCTTTCCAAGAAGCCCTGG + Intronic
1140876901 16:79161353-79161375 TCATCCTTAACAACAACCTTAGG - Intronic
1140960121 16:79903671-79903693 TCCTCCTTACTAACAAGACTTGG - Intergenic
1141875428 16:86820814-86820836 TCATCCTTGCCAACCAGGCTGGG + Intergenic
1143002103 17:3800921-3800943 CCGCCCTTCCCAACAAGCCTGGG + Intronic
1143949912 17:10624218-10624240 ACACCCTTAGCAAAAAGCCCAGG - Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1151535696 17:74737646-74737668 TAACCCTCACCAAGAAGCATGGG - Intronic
1153160192 18:2196179-2196201 TTAACATTACCAACAACCCTGGG - Intergenic
1158929046 18:62303019-62303041 TCTCCCTTTCCAAAATGCCTAGG + Intronic
1161087853 19:2343419-2343441 CCACCCTTCACAACAGGCCTAGG - Intronic
1165154621 19:33779468-33779490 TCAGCCTTCCCTACAAGCCCTGG + Intergenic
1165802929 19:38563946-38563968 TAATCCTCACAAACAAGCCTAGG - Intronic
1166127615 19:40725186-40725208 TCACTCACCCCAACAAGCCTGGG + Intronic
926631437 2:15140026-15140048 TCACCTTTACAACCTAGCCTTGG - Intergenic
929717337 2:44326469-44326491 ATCCTCTTACCAACAAGCCTGGG + Intronic
933026675 2:77268459-77268481 TCACTCTTACCATCCTGCCTTGG + Intronic
933645444 2:84809410-84809432 CCCGCCTAACCAACAAGCCTAGG - Intronic
933754025 2:85623630-85623652 TCACCCTTCCCTACAGGCCGGGG + Exonic
934066638 2:88347818-88347840 TCACCTTTAAGACCAAGCCTTGG + Intergenic
938959966 2:136331979-136332001 TTACCCTTACCCAGAAGCTTAGG + Intergenic
939864378 2:147456447-147456469 TCACCCTTATGACCTAGCCTTGG - Intergenic
942497147 2:176551830-176551852 TCACCCTTACCAATATGCGCTGG + Intergenic
946031296 2:216707305-216707327 TCACCCTTACCAACATGGGCTGG + Intergenic
946618650 2:221536733-221536755 TCACCCTTAACTACAAATCTGGG - Intronic
948988286 2:241539440-241539462 TCACACTTAACAAGAAGGCTGGG + Intergenic
1171570051 20:26240538-26240560 CCAACCTGACCAACAAGCCTGGG + Intergenic
1172432787 20:34906408-34906430 TCACCTTTCCCAACCAGCCAGGG + Intronic
1172936342 20:38623219-38623241 TCACCCTGAGAAACATGCCTAGG + Intronic
1179100450 21:38351484-38351506 TCAGCATTTCCAGCAAGCCTGGG - Intergenic
1179137641 21:38694520-38694542 TTTTCCTTAGCAACAAGCCTAGG + Intergenic
1180864159 22:19106281-19106303 CCACCCTTAGGAACAATCCTGGG + Intronic
1184626679 22:45738814-45738836 TCACTCTTTCCAGCAAGCCAGGG - Exonic
1185095840 22:48805722-48805744 TCTCCCTCACCAACCAGCCCGGG + Intronic
954855241 3:53638590-53638612 TTGCACTTACCAACAAACCTGGG + Intronic
956365197 3:68494055-68494077 TAACCCTTACAAACAACCCTGGG - Intronic
957109418 3:75933677-75933699 CCAACTTGACCAACAAGCCTAGG - Intronic
958581507 3:96031589-96031611 TTCCCCTCACCAACAAGACTAGG + Intergenic
959187101 3:103058090-103058112 TCACCCATCCCAACAGGCCCTGG + Intergenic
963130093 3:141849898-141849920 GCAACCCCACCAACAAGCCTTGG - Intergenic
965517223 3:169634500-169634522 TCACCCTTACCAACAAGCCTTGG - Intronic
965689991 3:171345601-171345623 TCACCCTCACCCTCAAGCCTAGG + Intronic
966303009 3:178499568-178499590 TCTCCCTTACCTGCATGCCTCGG - Intronic
967567164 3:190986675-190986697 TTCCCCTTCCTAACAAGCCTGGG - Intergenic
967612832 3:191528195-191528217 TCACCCTCACCAACATGAGTGGG + Intergenic
968612095 4:1561885-1561907 TCACCCCTCCCAACAACCCACGG + Intergenic
975473100 4:74793388-74793410 TCACTCCTACCTTCAAGCCTGGG - Intronic
978387288 4:108188776-108188798 TCTCCCATACCACCAAGCCAAGG - Intergenic
979929402 4:126611792-126611814 TCACCCTTACAATCAAACCTTGG - Intergenic
984613951 4:181874501-181874523 TCACCCTTACCACTCAGACTGGG + Intergenic
995265694 5:110156927-110156949 ACACCCTTACAAACACACCTAGG + Intergenic
997473958 5:134132037-134132059 TCACCCTGACCAGCCAGGCTGGG + Intronic
1000325670 5:160170282-160170304 TTAACCTTCACAACAAGCCTGGG + Intergenic
1003565116 6:7216145-7216167 TCACTCTTTCCTTCAAGCCTGGG - Intronic
1004788322 6:18994520-18994542 TCCCCATTACCAACATTCCTCGG + Intergenic
1006409189 6:33862600-33862622 CAACCCTTACCAACCAGGCTGGG + Intergenic
1006682762 6:35809041-35809063 GTACCCTTGCCAAGAAGCCTGGG + Intronic
1007373327 6:41441154-41441176 TCTCACTAGCCAACAAGCCTGGG + Intergenic
1008167930 6:48163552-48163574 TCACCTTTACCAACAACCCAAGG - Intergenic
1011513428 6:88126494-88126516 TCCTCCTTACAAACAAGCCTTGG - Intergenic
1013211816 6:107993742-107993764 TCACCCCTACATAAAAGCCTAGG - Intergenic
1015978379 6:138814272-138814294 TCAACCCACCCAACAAGCCTGGG + Intronic
1020183417 7:5940272-5940294 TCACTCATACCGACCAGCCTGGG + Intronic
1020299493 7:6784486-6784508 TCACTCATACCGACCAGCCTGGG - Intronic
1021270875 7:18583973-18583995 TGACCCTTACCCACAAGAATCGG - Intronic
1023534635 7:41195211-41195233 TCACCCTCACCAACATGGATAGG - Intergenic
1028504621 7:91557521-91557543 TCAGCCCCACCAACAAGCCTAGG + Intergenic
1035211511 7:157332168-157332190 TTACCCACATCAACAAGCCTCGG - Intergenic
1039305179 8:36254304-36254326 TTACCCTTACCAGCAAGCTCTGG + Intergenic
1040870961 8:52100214-52100236 TCTCCCTGACCTACAAGGCTTGG - Intergenic
1046386576 8:113514349-113514371 TCACCCTTAGCAGCAAGTCCCGG - Intergenic
1047937556 8:129797525-129797547 TCACCCCTACCCACATGCCATGG + Intergenic
1050574989 9:6985537-6985559 TCACCTTTGCCAAGAAACCTTGG - Intronic
1052137745 9:24936522-24936544 TCAGCCCTACCAGCAATCCTGGG - Intergenic
1056849883 9:90073498-90073520 TCACCCTTCCCATCAAGCAAGGG - Intergenic
1061432630 9:130540890-130540912 TCTCTCTTACCTCCAAGCCTTGG - Intergenic
1189791169 X:44606783-44606805 TCACCATTACCCTCCAGCCTGGG + Intergenic
1191776450 X:64819762-64819784 TCACCCTTCCCAATAGGCCCTGG - Intergenic
1198654480 X:138898671-138898693 TCCCCCTTCCCAACAAACTTGGG - Intronic
1200268321 X:154658536-154658558 TCACCCCTACCACCAAACCTAGG - Intergenic
1201385970 Y:13439859-13439881 TCACCCATACCAACAAACCCAGG + Intronic
1201955231 Y:19615771-19615793 TCACCTTATCCAACAAGCCCTGG + Intergenic