ID: 965517694

View in Genome Browser
Species Human (GRCh38)
Location 3:169639219-169639241
Sequence CTGAATCCATCGCTGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965517694_965517697 -6 Left 965517694 3:169639219-169639241 CCAAGCTCCAGCGATGGATTCAG 0: 1
1: 0
2: 2
3: 26
4: 147
Right 965517697 3:169639236-169639258 ATTCAGACTTGGTTCAGAGATGG 0: 1
1: 0
2: 0
3: 19
4: 214
965517694_965517698 -5 Left 965517694 3:169639219-169639241 CCAAGCTCCAGCGATGGATTCAG 0: 1
1: 0
2: 2
3: 26
4: 147
Right 965517698 3:169639237-169639259 TTCAGACTTGGTTCAGAGATGGG 0: 1
1: 0
2: 0
3: 24
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965517694 Original CRISPR CTGAATCCATCGCTGGAGCT TGG (reversed) Intronic
900298570 1:1965178-1965200 CTGCCACCAGCGCTGGAGCTGGG + Intronic
901758423 1:11455418-11455440 CTGAAGCCAGTGGTGGAGCTTGG + Intergenic
904099590 1:28013221-28013243 GTGACTCCAAAGCTGGAGCTGGG + Exonic
904312713 1:29639727-29639749 CTGAATCCCTCCCTGGAGATGGG + Intergenic
907468247 1:54653830-54653852 CTGATACCATAGCTGGAGCCAGG - Exonic
913092599 1:115489174-115489196 TTGAATCTATAGCTCGAGCTGGG - Intergenic
916560560 1:165931127-165931149 GTGGATCCATGGCTGGGGCTGGG + Intergenic
917393842 1:174569714-174569736 TTGAATCCATCTCTGGACATGGG - Intronic
917792097 1:178505559-178505581 CTGAATCCACTGCAGGAGCCAGG - Intergenic
920628989 1:207633146-207633168 TTGAATTCAGAGCTGGAGCTGGG - Intronic
921985466 1:221307462-221307484 CTAAAACTATGGCTGGAGCTAGG + Intergenic
922206881 1:223455817-223455839 CTGAGTCCAGTGGTGGAGCTGGG - Intergenic
922494760 1:226047825-226047847 CTGAATCCACCTCTGCAGTTTGG - Intergenic
922676683 1:227557478-227557500 CTGATTCCATCGTTGGAGGCTGG + Intergenic
924482999 1:244453557-244453579 CTGGATCCATTGCTGGAGGGGGG - Intergenic
1065005205 10:21373294-21373316 CTGAATGCTTAGCTGGGGCTGGG - Intergenic
1066392119 10:34986015-34986037 CTGGGTCCATTGCTGGAGCTGGG - Intergenic
1067712677 10:48662472-48662494 CTGAACCCATCGTTGCAGCTGGG + Intergenic
1069534676 10:69244287-69244309 CTGATTCCAGGGCTGGGGCTAGG - Intronic
1069641443 10:69958142-69958164 CAGAATCCATCCCTGGAGGCTGG + Intronic
1069723970 10:70565888-70565910 CTGAATCCCCCACTGGGGCTGGG + Intronic
1075317023 10:121460924-121460946 CTGGCTCCATCCCTGGAGCCAGG + Intergenic
1075708968 10:124520479-124520501 GTGACTCCATGTCTGGAGCTTGG - Intronic
1076310005 10:129498734-129498756 CTGAATCCAGGGCTGGGGCAGGG - Intronic
1077353509 11:2104013-2104035 CTGCGACCATGGCTGGAGCTGGG - Intergenic
1077493671 11:2874471-2874493 CTGATTCCATCCCTGTAGCCTGG - Intergenic
1078231284 11:9445173-9445195 CTCAATTCATCCCTGGTGCTGGG - Exonic
1078316645 11:10298885-10298907 TTGAAACCATCGGTGAAGCTGGG - Intergenic
1083903414 11:65654830-65654852 CTGATACCATGGCTGGAGCAGGG + Exonic
1086744482 11:90408001-90408023 CTGATTCCACAGCTGGACCTGGG + Intergenic
1087971481 11:104490396-104490418 CTGGATCCATCGCTGGAACGGGG - Intergenic
1088007536 11:104961101-104961123 CTGGATCCATCGCTGGAGCGGGG - Intronic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1089620783 11:119721065-119721087 CAGAGTCCATCTCTGGTGCTAGG + Intronic
1091878896 12:3960461-3960483 CTGAATCCATCTGTGGAGATTGG - Intergenic
1093101774 12:15037148-15037170 CTGGATCCATCGCTGGAGTCGGG + Intergenic
1094431531 12:30374801-30374823 CTGAATCCATTGCTGAAGGGGGG + Intergenic
1094524055 12:31220076-31220098 CAGAATCCATCACTGAGGCTGGG - Intergenic
1100270383 12:93018963-93018985 GTGAATCCATCTCAGGAGCCAGG - Intergenic
1101148703 12:101865490-101865512 CTGGATCCATTGCTGGAGGGGGG + Intergenic
1101979499 12:109393358-109393380 GTGAATCCATACCAGGAGCTCGG + Exonic
1102636373 12:114328014-114328036 ATGAATCCATCACTGGACTTGGG - Intergenic
1104055765 12:125228764-125228786 CAGGATCCCTCTCTGGAGCTGGG - Intronic
1105825834 13:24122064-24122086 CTCAATTCATCCCTGGTGCTGGG + Intronic
1109469967 13:62791449-62791471 CTGAATCCATTGCTGGAGGGGGG + Intergenic
1109525144 13:63566069-63566091 CTGGGTCCATAGCTGCAGCTTGG - Intergenic
1116872913 14:50084782-50084804 CTCAAGCCTTCGCTGGTGCTAGG + Intronic
1117203324 14:53414716-53414738 CTGAGCCCATCGCTGTAGCCAGG + Intergenic
1117817282 14:59611258-59611280 CTGGATCCATCACTGGAGGGGGG - Intronic
1117955785 14:61122751-61122773 CTGAGTCCATGGCAGGATCTGGG + Intergenic
1118231467 14:63954408-63954430 CTGAATCAAACTCTGGAGGTGGG - Intronic
1120172626 14:81260898-81260920 CTGAATCATTCACTGGATCTTGG + Exonic
1120699535 14:87683570-87683592 CTGATTCCAGGGCTGGACCTGGG + Intergenic
1122084978 14:99293865-99293887 CTGATTCCAGGGCTGGAGCAAGG + Intergenic
1122128912 14:99593829-99593851 CTGCACCCATCTCTGGGGCTGGG + Intronic
1123776868 15:23589069-23589091 CTGAAGCTATTGCTGGAGGTGGG + Intronic
1124657886 15:31523573-31523595 CTGAATCCATGCCTGGACCTCGG + Intronic
1126900093 15:53305802-53305824 CAGAATCTGTCTCTGGAGCTGGG + Intergenic
1128355456 15:66923422-66923444 CAGGATCCATCTCTGGGGCTGGG + Intergenic
1128520820 15:68373641-68373663 CTGACTCAATCACTGCAGCTGGG - Intronic
1128640269 15:69330931-69330953 CTGGATCCATCACTGGAGTGGGG - Intronic
1133180533 16:4050869-4050891 CTGATTCCAGGGCTGGAGCAAGG + Intronic
1133789295 16:8997067-8997089 CAGAGCCCATCCCTGGAGCTGGG - Intergenic
1135417970 16:22283650-22283672 CTGGACCAATCGCTGTAGCTTGG + Intronic
1137485103 16:48883979-48884001 CTGAATCAATCACTGGGGCTGGG + Intergenic
1137536463 16:49330707-49330729 CAGACTCCATCGCAGGTGCTGGG + Intergenic
1137647342 16:50087610-50087632 CAGTATCCATTGCTGGAGCGAGG + Intronic
1137726053 16:50657506-50657528 CTGACTCCATCCCCAGAGCTGGG - Intergenic
1139379298 16:66520431-66520453 CTGAACGCATTGCTGGAACTAGG - Intronic
1145095768 17:20024726-20024748 CAGAGTCCTTGGCTGGAGCTGGG - Intronic
1148704891 17:49621161-49621183 CTGAACCAATCCCTGGAGCAGGG - Intronic
1151238309 17:72737855-72737877 CTCAATCCCTCTCTGGGGCTGGG + Intronic
1154366621 18:13716335-13716357 CGGGATCCATCATTGGAGCTGGG - Intronic
1156516420 18:37684327-37684349 CTCAGTCCATGCCTGGAGCTGGG + Intergenic
1157089797 18:44624173-44624195 CTGAATCCAATCCTGCAGCTAGG + Intergenic
1158503871 18:58028729-58028751 CTGAACCCATCACTGTGGCTGGG + Intergenic
1160298499 18:77658404-77658426 CTCACTTCAACGCTGGAGCTAGG + Intergenic
1160704944 19:525229-525251 CTGAACCCATCGCTGAGGCTGGG - Intergenic
1161126448 19:2560601-2560623 CTGGATCCTTCTCTGGAGCAGGG - Intronic
1163317738 19:16553113-16553135 CTGGATCCATCTCTGTGGCTGGG + Exonic
1163364377 19:16867967-16867989 CTGGATCCCTCCCTGGGGCTGGG + Intronic
1166555680 19:43698277-43698299 CTGAATCCACCACCTGAGCTGGG + Intergenic
1167471698 19:49679310-49679332 CTGAGTCCAAGGCAGGAGCTGGG + Intronic
1167598418 19:50439461-50439483 GTGAATGCATGGATGGAGCTTGG - Intronic
928672005 2:33611754-33611776 CTGAATCCATCACTGGAGGGGGG - Intergenic
929225710 2:39510137-39510159 CTGAACCCAAGGCTGGGGCTGGG + Intergenic
933358376 2:81244374-81244396 ATTAATCCATCAGTGGAGCTGGG + Intergenic
935261787 2:101362065-101362087 CTGAATCCATCACTATAGCCAGG - Intronic
939548228 2:143580564-143580586 CTGAATTCATCACAGGAACTTGG - Intronic
944236119 2:197442783-197442805 CTCAATCAATCTCTGGAGTTTGG - Intergenic
1169508014 20:6233861-6233883 TTGAATCCTTCTCTTGAGCTGGG + Intergenic
1170436132 20:16331106-16331128 CTGAATGCATAGCTGGACCCAGG + Intronic
1170646434 20:18200165-18200187 CTGAATGCAACACTGGATCTTGG - Intergenic
1171452560 20:25246844-25246866 GTGAATCCCGAGCTGGAGCTGGG + Intergenic
1173235282 20:41239617-41239639 CAAGATCCATCCCTGGAGCTGGG + Intronic
1173382911 20:42561981-42562003 CTGATTTCAACGCTGGAGCCAGG - Intronic
1173478244 20:43378503-43378525 CTGAATCAAACTCTGGAGGTGGG + Intergenic
1175222701 20:57426491-57426513 CTGCCTCCATCGCTGGGGATGGG - Intergenic
1176126051 20:63475328-63475350 CTGTCTCCTCCGCTGGAGCTGGG - Intergenic
1181041115 22:20193066-20193088 CTGAATCCATCAACTGAGCTGGG - Intergenic
1181562718 22:23715066-23715088 CTGGATCCATCGCTCCAGCAGGG + Intergenic
1184992617 22:48180921-48180943 CTGAATCCACTCCTAGAGCTGGG + Intergenic
949954365 3:9255568-9255590 CTGAACCAATCGCTGGAGCCAGG + Intronic
949999002 3:9641960-9641982 CTGGATCCATCGCTGGAGAGGGG + Intergenic
953316869 3:41936125-41936147 CTGAATCTGTCTCTGGTGCTTGG - Intronic
953612697 3:44460905-44460927 CTGGATCCATCGCTGGAGGGGGG - Intronic
953809109 3:46096808-46096830 CTATATCCATCGCTGGTGATGGG - Intergenic
954648397 3:52145117-52145139 CTGAGCCCATCCCTGGAACTGGG + Intronic
955412619 3:58665620-58665642 CTGAGTCCATGGCTGGAAGTGGG - Intronic
958812482 3:98877750-98877772 CTGATTCCAGGGCTGGAGCAGGG + Intronic
960338697 3:116448410-116448432 CTGTTTCCATTGCTGGTGCTAGG + Intronic
960496447 3:118381602-118381624 CCAAATCCATCACTGGAGCTGGG + Intergenic
960868982 3:122230557-122230579 CTGAACCCATCTCTGTAGGTGGG + Intronic
961021701 3:123513000-123513022 CTGATTCCAGGGCTGGGGCTGGG + Intronic
961572312 3:127808492-127808514 CTGAACCAATCACTGTAGCTGGG + Intronic
962395174 3:135009193-135009215 CTGAATCCAACTCTGGAGATGGG - Intronic
965517694 3:169639219-169639241 CTGAATCCATCGCTGGAGCTTGG - Intronic
966935661 3:184707031-184707053 CTGGATCCATCACTGGAGGGGGG + Intergenic
968761767 4:2446012-2446034 CTCAGTCCATTGCTGGTGCTTGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
971355129 4:25888467-25888489 CTGAAGCCACCGGTGGAGGTGGG - Intronic
971814376 4:31467209-31467231 CTGGATCCATTGCTGGAGGTGGG + Intergenic
973947541 4:55974093-55974115 CTGTATCCTTAGCTGGTGCTGGG + Intronic
975547546 4:75575089-75575111 CTGAATCAATCACAGTAGCTAGG - Intergenic
976780151 4:88749831-88749853 CTGAATCCTTCGTGTGAGCTGGG + Exonic
977526803 4:98155987-98156009 CTGGATCCATCACTGGAGGGAGG - Intergenic
981825564 4:148936838-148936860 CTGATTCTAAGGCTGGAGCTGGG - Intergenic
985529433 5:425062-425084 CTGACTCCAGCACTGTAGCTGGG + Intronic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
992722893 5:79578193-79578215 GTGGATCCATTGCTGGAGTTGGG - Intergenic
1001940989 5:175739269-175739291 CTGGGTCCATGCCTGGAGCTGGG - Intergenic
1001986414 5:176077076-176077098 CTGAATCCACAGCAGGAGGTTGG - Intronic
1002230453 5:177761049-177761071 CTGAATCCACAGCAGGAGGTTGG + Intronic
1002264883 5:178022698-178022720 CTGAATCCACAGCAGGAGGTTGG - Intronic
1003629129 6:7770885-7770907 GTGAATCCATCTCTGTAGGTGGG + Intronic
1004872639 6:19922736-19922758 CTGCATCCAAGGCTGGAGTTAGG + Intergenic
1005592718 6:27345449-27345471 CAGTATCCATAGCTGGAGTTTGG + Intergenic
1005937756 6:30536817-30536839 CTGATTCCACATCTGGAGCTGGG + Intergenic
1006407067 6:33851623-33851645 CTGAATCAATTGCTGCAGCTGGG - Intergenic
1006445856 6:34079448-34079470 CTGAATGCAACGATGAAGCTGGG - Intronic
1007126727 6:39431918-39431940 CTGAATTCACCGCTGGATTTTGG + Intronic
1010952118 6:82049284-82049306 CTGAGTCCATGGCTGGTGCAGGG - Intergenic
1013309531 6:108880343-108880365 CTGAATCAACTGCTGTAGCTGGG - Intronic
1017195433 6:151695176-151695198 TTGAATGCATACCTGGAGCTTGG + Intronic
1017647464 6:156552165-156552187 CTGAATCCGTGTCTGGAGTTGGG - Intergenic
1018801583 6:167226942-167226964 CTGGATCCATCGCTGGAGAGGGG - Intergenic
1021107659 7:16656994-16657016 CTGACTCCAAGGCTGGAGCAGGG - Intronic
1023800105 7:43826651-43826673 CTGGATCCATCGCTGGAGGGGGG - Intergenic
1026759286 7:73114364-73114386 CTGAGTCCATTGCTGGTGCTGGG + Intergenic
1027088122 7:75279109-75279131 CTGAGTCCATTGCTGGTGCTGGG - Intergenic
1027810100 7:82885376-82885398 CTGTATCCCTTTCTGGAGCTTGG - Intronic
1029394229 7:100296265-100296287 GTGAGTCCATTGCTGGTGCTGGG - Intergenic
1030364237 7:108627500-108627522 CTGGATCCATCGCTGGATTGGGG + Intergenic
1031714930 7:125097319-125097341 CTGACTCCATCACTTGAGATGGG + Intergenic
1033305354 7:140221528-140221550 CTGAATGCATCTCTGGGGCTTGG + Intergenic
1034072182 7:148196899-148196921 CTGAATCCCTCCCTTGAGCCTGG - Intronic
1034424343 7:151006804-151006826 CTGAAGCCGTCCCTGGGGCTGGG + Intronic
1034444879 7:151108731-151108753 CAGAATCCCAGGCTGGAGCTTGG - Intronic
1034591450 7:152143453-152143475 CTGAATCCAGCTCTGGAGGTGGG - Intronic
1035890398 8:3336765-3336787 CTGCATGCATCGCTGGCCCTGGG + Intronic
1040531141 8:48267369-48267391 CAGGAACCATCGCTGGACCTTGG + Intergenic
1043552193 8:81386856-81386878 CTGAATCCTACCCTGGAGCCAGG - Intergenic
1046010368 8:108539154-108539176 CTGAATTTATTTCTGGAGCTTGG + Intergenic
1048091357 8:131243936-131243958 CAGAATCCACAGCAGGAGCTTGG + Intergenic
1052038912 9:23715596-23715618 CTGAAGCCATTGCTGGAGAATGG - Intronic
1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG + Intronic
1058615880 9:106827367-106827389 CTCAATCCATCGCTAGAGCTTGG - Intergenic
1059689931 9:116675100-116675122 CTGGATCCATTGCTGGAGCGTGG - Intronic
1060445334 9:123681876-123681898 CTGATTCCAGGGCTGGGGCTGGG + Intronic
1061830887 9:133293580-133293602 CTGGATCCATCGCTAGAGAGGGG + Intergenic
1061899450 9:133665623-133665645 CTGAGTCCGGCGGTGGAGCTGGG - Intronic
1061973272 9:134055984-134056006 CGGTGTCCATGGCTGGAGCTGGG - Intronic
1187956952 X:24528539-24528561 CTGAATGCATAGCTGCCGCTTGG + Intronic
1190928448 X:54928957-54928979 CTGAAGCCACCACTGGAGCTGGG - Exonic
1192606228 X:72521508-72521530 CTGATTCCAGGGCTGGAGCAGGG + Intronic
1201749091 Y:17413106-17413128 CTGGATCCATTGCTGGAGGGGGG - Intergenic