ID: 965521043

View in Genome Browser
Species Human (GRCh38)
Location 3:169668551-169668573
Sequence GCCACGGGCCGCAAAGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965521040_965521043 -10 Left 965521040 3:169668538-169668560 CCAGGGAAAGGGAGCCACGGGCC No data
Right 965521043 3:169668551-169668573 GCCACGGGCCGCAAAGGGCGCGG No data
965521036_965521043 0 Left 965521036 3:169668528-169668550 CCACGTCCAGCCAGGGAAAGGGA No data
Right 965521043 3:169668551-169668573 GCCACGGGCCGCAAAGGGCGCGG No data
965521037_965521043 -6 Left 965521037 3:169668534-169668556 CCAGCCAGGGAAAGGGAGCCACG No data
Right 965521043 3:169668551-169668573 GCCACGGGCCGCAAAGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965521043 Original CRISPR GCCACGGGCCGCAAAGGGCG CGG Intergenic
No off target data available for this crispr