ID: 965521174

View in Genome Browser
Species Human (GRCh38)
Location 3:169669221-169669243
Sequence CTGGCCGCCCTCTCCGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965521168_965521174 -10 Left 965521168 3:169669208-169669230 CCCACCAGCCGCTCTGGCCGCCC No data
Right 965521174 3:169669221-169669243 CTGGCCGCCCTCTCCGGGCTCGG No data
965521162_965521174 22 Left 965521162 3:169669176-169669198 CCTATTGGCACCAGGTGCTAAGC No data
Right 965521174 3:169669221-169669243 CTGGCCGCCCTCTCCGGGCTCGG No data
965521166_965521174 -8 Left 965521166 3:169669206-169669228 CCCCCACCAGCCGCTCTGGCCGC No data
Right 965521174 3:169669221-169669243 CTGGCCGCCCTCTCCGGGCTCGG No data
965521164_965521174 12 Left 965521164 3:169669186-169669208 CCAGGTGCTAAGCTCGCGGTCCC No data
Right 965521174 3:169669221-169669243 CTGGCCGCCCTCTCCGGGCTCGG No data
965521167_965521174 -9 Left 965521167 3:169669207-169669229 CCCCACCAGCCGCTCTGGCCGCC No data
Right 965521174 3:169669221-169669243 CTGGCCGCCCTCTCCGGGCTCGG No data
965521161_965521174 27 Left 965521161 3:169669171-169669193 CCGTGCCTATTGGCACCAGGTGC No data
Right 965521174 3:169669221-169669243 CTGGCCGCCCTCTCCGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965521174 Original CRISPR CTGGCCGCCCTCTCCGGGCT CGG Intergenic