ID: 965522991

View in Genome Browser
Species Human (GRCh38)
Location 3:169687563-169687585
Sequence GCTCTGTGGGGACCCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965522991_965522998 14 Left 965522991 3:169687563-169687585 CCTTGAGAGGGTCCCCACAGAGC No data
Right 965522998 3:169687600-169687622 AGATGGTTCCTCACTCTTCCCGG No data
965522991_965522996 -3 Left 965522991 3:169687563-169687585 CCTTGAGAGGGTCCCCACAGAGC No data
Right 965522996 3:169687583-169687605 AGCCTTGCATGTAGGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965522991 Original CRISPR GCTCTGTGGGGACCCTCTCA AGG (reversed) Intergenic
No off target data available for this crispr