ID: 965523677

View in Genome Browser
Species Human (GRCh38)
Location 3:169694414-169694436
Sequence CTTGTGCTTCTTTTTGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965523677_965523679 5 Left 965523677 3:169694414-169694436 CCTTACTCAAAAAGAAGCACAAG No data
Right 965523679 3:169694442-169694464 GGCCATCTAGTATTTCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965523677 Original CRISPR CTTGTGCTTCTTTTTGAGTA AGG (reversed) Intergenic