ID: 965526674

View in Genome Browser
Species Human (GRCh38)
Location 3:169727321-169727343
Sequence CCTCAAAAACTGAGGATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965526674_965526679 -6 Left 965526674 3:169727321-169727343 CCTTCTATCCTCAGTTTTTGAGG No data
Right 965526679 3:169727338-169727360 TTGAGGGTTTTTATTATGAAGGG 0: 36
1: 356
2: 1335
3: 9144
4: 5208
965526674_965526678 -7 Left 965526674 3:169727321-169727343 CCTTCTATCCTCAGTTTTTGAGG No data
Right 965526678 3:169727337-169727359 TTTGAGGGTTTTTATTATGAAGG 0: 16
1: 167
2: 507
3: 1413
4: 9592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965526674 Original CRISPR CCTCAAAAACTGAGGATAGA AGG (reversed) Intergenic
No off target data available for this crispr