ID: 965530464

View in Genome Browser
Species Human (GRCh38)
Location 3:169765518-169765540
Sequence CATTCTAAGGAGAAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965530464_965530473 9 Left 965530464 3:169765518-169765540 CCTGCCCCCTTCTCCTTAGAATG 0: 1
1: 0
2: 1
3: 13
4: 261
Right 965530473 3:169765550-169765572 GCCTCTCCTTGAGCAGAGGATGG 0: 1
1: 0
2: 6
3: 31
4: 267
965530464_965530471 5 Left 965530464 3:169765518-169765540 CCTGCCCCCTTCTCCTTAGAATG 0: 1
1: 0
2: 1
3: 13
4: 261
Right 965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG 0: 1
1: 1
2: 2
3: 25
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965530464 Original CRISPR CATTCTAAGGAGAAGGGGGC AGG (reversed) Intergenic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901531043 1:9852678-9852700 CTTGCTAATCAGAAGGGGGCTGG + Intronic
902688749 1:18096480-18096502 CATTCTCAGGAGATGGGGCCAGG + Intergenic
903391987 1:22971215-22971237 CATTTTGAGGAGGAGGGGGGTGG - Intergenic
904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG + Intergenic
905708664 1:40082070-40082092 CATTTTGAGGAGGTGGGGGCTGG - Intronic
908383673 1:63620210-63620232 CATTCTAACGGGAAGGGCACAGG - Intronic
910012880 1:82486982-82487004 CTTTCTTAAGAGAAGGGGGGGGG + Intergenic
911126169 1:94343130-94343152 CACTCCAAAGAGAAGGGAGCGGG - Intergenic
912623017 1:111184362-111184384 CATATTAAGGAGAATGGGGGTGG + Exonic
912776736 1:112510263-112510285 CCATCCAAGGAGTAGGGGGCAGG - Intronic
916033641 1:160901603-160901625 CCTCCAAAGGAGAAGGGTGCAGG - Intergenic
916063953 1:161121204-161121226 CATGCTTGGGAGAATGGGGCTGG - Exonic
918301024 1:183203992-183204014 CATTTAAAGGACAATGGGGCAGG + Intronic
918642587 1:186861284-186861306 CGTTCTAAGGATAAGGTCGCTGG - Intronic
919897140 1:202015940-202015962 CATTCACAGGAGAAAGGAGCTGG - Exonic
920674760 1:208031265-208031287 GGTTCTCAGGAGAAGGGAGCTGG - Intronic
921433633 1:215091228-215091250 CATTCTAAGCAGAATGGGCATGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
1063179470 10:3584773-3584795 CCTTCTTAGTAGACGGGGGCTGG - Intergenic
1070420227 10:76229086-76229108 AATTCTAAGGAGAATGGAGCTGG + Intronic
1072753291 10:97999607-97999629 GTTTCTGAGAAGAAGGGGGCAGG + Intronic
1073772707 10:106752762-106752784 AATGCTAAGGAGAATGGGGGAGG + Intronic
1075568972 10:123525216-123525238 CATTTTAAGGATAAAGAGGCTGG - Intergenic
1076528887 10:131131193-131131215 CATTCTTGGGAGAAGGCGGGAGG + Intronic
1076598268 10:131639142-131639164 CATTCTGAGGACAAAGGGACAGG - Intergenic
1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG + Intronic
1079249158 11:18774507-18774529 TACTCTGAGGAGGAGGGGGCTGG + Intronic
1079450141 11:20593785-20593807 CATTATAAGGATAAGGGTGGGGG + Intergenic
1081397092 11:42599070-42599092 CATTATCAGGATAATGGGGCAGG + Intergenic
1081554180 11:44142829-44142851 TATTCTAAGCTGAAGGGAGCAGG - Intronic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084693383 11:70739698-70739720 CATTCTGAGGAGCAGGGGTTAGG - Intronic
1087141728 11:94770598-94770620 CATTTTAAAAAGAAGGGGGAGGG - Intronic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1087698063 11:101403540-101403562 CAGCCTAAGGAGGAGGGGACAGG + Intergenic
1087820285 11:102704042-102704064 CATCTCAAGGAAAAGGGGGCAGG - Intronic
1089116604 11:116100266-116100288 CATTCTGAAGAGCAGGGGTCAGG + Intergenic
1090366696 11:126212196-126212218 CATCCTTAGGAGAAGGGTACAGG - Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1097208207 12:57342310-57342332 CATTCAAGGGTGAAGGGGGCGGG - Intronic
1101051556 12:100868985-100869007 CATCCTGTGGAGAAGGGGGTTGG - Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1103236995 12:119381691-119381713 CATTCTAAGGACGAGGAAGCTGG + Intronic
1103316797 12:120062711-120062733 CATTCCAAGGGAAAGGGGGAAGG - Intronic
1103349840 12:120276544-120276566 TTTTCTCAGGTGAAGGGGGCTGG + Intergenic
1103983344 12:124750922-124750944 CTTTCTGGGGTGAAGGGGGCGGG + Intergenic
1106769853 13:32951577-32951599 CTTCCTAAGGAGAAAGGGGAGGG + Intergenic
1106870182 13:34011164-34011186 AATTCTAGGGAGAAAAGGGCGGG + Intergenic
1108273177 13:48783091-48783113 CATTCCTAGGGGAAGGGGGAGGG - Intergenic
1108478563 13:50843995-50844017 CCTTCGAAGGAGGTGGGGGCGGG - Intergenic
1109061901 13:57631388-57631410 CATTTAAAGGAGGAGGGGGGAGG - Intergenic
1117318742 14:54600221-54600243 CATGCTCAGGAGAAGGTGCCTGG - Intronic
1119179235 14:72593812-72593834 CATTCTAAGAAGAGGTGGGGTGG - Intergenic
1119478123 14:74942792-74942814 CCTCCTATGGAGGAGGGGGCAGG + Intronic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126112943 15:45186415-45186437 TCTGCTGAGGAGAAGGGGGCAGG + Intronic
1126333796 15:47564656-47564678 AATTCTAGGGAGAAAAGGGCGGG + Intronic
1128099306 15:64985380-64985402 CATTCTAAGGAGAATGAAGGGGG + Intronic
1128371368 15:67041956-67041978 CTTTCTAAAGAGAAGGGGCAAGG + Intergenic
1128804282 15:70519077-70519099 CATTCTAAGGGGAAAAAGGCAGG - Intergenic
1129233564 15:74209869-74209891 AATTCTCAGGAGAAGGGCCCTGG + Intronic
1129627473 15:77217311-77217333 CATTCAAAGCAAAAGTGGGCTGG + Intronic
1130220497 15:82015344-82015366 CCTTCTAAGAAGCAGTGGGCTGG - Intergenic
1130954202 15:88615365-88615387 CATTCTCAGGAGTTGGGGGAGGG + Intergenic
1132382216 15:101374190-101374212 CCTCCTCAGGAGAAGGGAGCGGG - Intronic
1132464448 16:71322-71344 CATTCTCAGGAAAAGGGGCCCGG + Intronic
1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG + Intronic
1133412667 16:5581120-5581142 GATCCAGAGGAGAAGGGGGCAGG + Intergenic
1135451850 16:22565351-22565373 CATTAAACGGAGATGGGGGCCGG + Intergenic
1137744850 16:50812983-50813005 CATGCCAAGGAGAAAGGGACTGG - Intergenic
1139253559 16:65519705-65519727 CATTATAAAGAGAAGGGGAGAGG - Intergenic
1141879575 16:86848831-86848853 CATTCCTAGGAGAAGGGCACTGG + Intergenic
1142817031 17:2434681-2434703 AAACCTAAGGAGAAGGGAGCTGG + Intronic
1142905343 17:3037375-3037397 CATGCTAAGGAGCAGGAAGCGGG - Exonic
1146101140 17:29983581-29983603 CATTCTAAGTGTAAGGGGACTGG - Intronic
1146675189 17:34768435-34768457 CATTCAGAGGATAAGGGAGCTGG - Intergenic
1146768773 17:35548909-35548931 CATCCAAAGGCGAAGGGGACTGG - Exonic
1147166864 17:38598168-38598190 CTTTCCATGGATAAGGGGGCTGG + Intronic
1147209879 17:38866751-38866773 CATTTTGTGGAGATGGGGGCAGG - Intergenic
1147364109 17:39949176-39949198 CATTCTCAGAAGCAGGGAGCTGG + Intergenic
1148213219 17:45820491-45820513 CCTTCTAAGGAGATGGGGAGGGG - Intronic
1148217038 17:45838980-45839002 CATTTTAAGGAGCTGGGGGGTGG - Intergenic
1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150160029 17:62889605-62889627 TATTCTATGGAGAAGGGTGGTGG + Intergenic
1151352302 17:73539024-73539046 CCCTCTAAGAGGAAGGGGGCAGG + Intronic
1152202358 17:78954500-78954522 CATTCTGTTGAGAAGGGGACGGG + Intergenic
1203165393 17_GL000205v2_random:88663-88685 TAGTCTAAGGAGAAAGAGGCCGG - Intergenic
1153448012 18:5195937-5195959 CATTCTGAGGGGGAGGGGGAGGG + Intronic
1156419005 18:36930277-36930299 CATTCTAAGGAGAGAGAGACAGG - Intronic
1157090181 18:44627635-44627657 CAGTCTCAGGAGATGGGGCCTGG + Intergenic
1157600096 18:48888441-48888463 GCTTCTCAGGAGAAGGGGGGCGG - Intergenic
1159437377 18:68436440-68436462 CACACTAAGGAGAAAGGGTCTGG + Intergenic
1159666066 18:71162035-71162057 AATTCTAGGCAGAAGAGGGCAGG + Intergenic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1161740685 19:6019177-6019199 TATTCAAAGGACAAGAGGGCGGG - Intronic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1165889303 19:39100930-39100952 CTTTCTAGGGAGAAGGGCCCAGG - Exonic
1166895836 19:46021568-46021590 CATTCTAAGGAGGAGGTAGCTGG + Intronic
1167129033 19:47572644-47572666 GATTCTGAGCAGAAGGGGCCTGG + Intergenic
1167558035 19:50207630-50207652 CATTTTATGGAGAAGGAGTCAGG + Intronic
927642650 2:24855195-24855217 CTTCCTAAGAAGAAGGGGGTGGG - Intronic
927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG + Exonic
928024507 2:27728707-27728729 CATTGGAAGGAGTAGGGGGATGG - Intergenic
928113498 2:28528476-28528498 CACTCTCAGGAGAAGGGAGGGGG + Intronic
929426033 2:41845652-41845674 CATTCCAAGGGGAAGAGTGCAGG - Intergenic
929811838 2:45195371-45195393 CATTCTAAGTAGAAGGGCTCTGG - Intergenic
930632552 2:53769544-53769566 CTTTAAAAGGAGAAAGGGGCTGG + Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931465851 2:62486231-62486253 CATTCTAATGATAAGGCTGCTGG + Intergenic
931637652 2:64355210-64355232 CATTCTAAAGCTAAGGTGGCAGG - Intergenic
933053988 2:77638340-77638362 CACTCTTGGGAGAAGGGGGAGGG - Intergenic
933981548 2:87554870-87554892 CATTCTCTGAAGATGGGGGCAGG - Intergenic
935314461 2:101817677-101817699 CTTTCCATGGAGAAGAGGGCGGG + Intronic
935426980 2:102929892-102929914 CGTTCTAGGCAGAAGGGGGGAGG - Intergenic
936312288 2:111395946-111395968 CATTCTCTGAAGATGGGGGCAGG + Intergenic
938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG + Intergenic
938727745 2:134121752-134121774 CATTCTAAGGAGATGCGAGTGGG + Intronic
939093958 2:137811125-137811147 CTTTCTAAGGATAAGCGGTCAGG + Intergenic
942076329 2:172359904-172359926 CATTCTAGGGAGCAGGGGTTAGG + Intergenic
945233660 2:207614515-207614537 CAGCCTAAGGAGAAGTGGACTGG - Intronic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG + Intronic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948532240 2:238616668-238616690 CATTCCAGGAAGAAGGGGGTGGG - Intergenic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1169908855 20:10630646-10630668 CATGCTGAGCAGAAGGGCGCTGG - Intronic
1171040892 20:21762554-21762576 TATTTTAAGGAAAAAGGGGCTGG - Intergenic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1172328653 20:34058076-34058098 CTTTTTGAGGGGAAGGGGGCCGG + Intronic
1172382109 20:34503289-34503311 TATTTTAATTAGAAGGGGGCAGG - Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172848067 20:37941819-37941841 TTTTCTAAGAAGAAGGGGCCAGG + Intronic
1174211278 20:48880463-48880485 CATTCTAAGGATAGTGAGGCAGG - Intergenic
1174814835 20:53677829-53677851 CAATCAAAGGGGGAGGGGGCAGG - Intergenic
1175128692 20:56772817-56772839 CATTCCGAGGAGAAAGGGCCAGG - Intergenic
1175802472 20:61808785-61808807 CAGTCAAAGGTGGAGGGGGCAGG - Intronic
1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176391461 21:6218160-6218182 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG + Intergenic
1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176507123 21:7658591-7658613 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178369614 21:32016642-32016664 CCTTCTAAGGAGGTGGGGGTGGG + Intronic
1178742076 21:35210643-35210665 CACTCTAGAGAGAATGGGGCAGG - Intronic
1179723317 21:43328314-43328336 CAATCCCTGGAGAAGGGGGCTGG + Intergenic
1182264754 22:29105552-29105574 AATTTTAAGAAGAAAGGGGCAGG + Intronic
1182506957 22:30790293-30790315 CTTTTTAAGGAGGGGGGGGCGGG + Intronic
1183364015 22:37397740-37397762 CAATGTAAGAAGAAGTGGGCAGG - Intronic
1184724009 22:46332497-46332519 CATCCTATGGAGAAAGGGGCTGG - Intronic
1184742601 22:46437790-46437812 CATTCTAAAGAGAGGGGGTTTGG - Intronic
950065507 3:10108397-10108419 CATTCCAATGAGGTGGGGGCGGG - Intergenic
950189625 3:10967596-10967618 AATGCTATGGAGAAGGGGTCAGG + Intergenic
950321297 3:12056681-12056703 CATGGTAATGAGTAGGGGGCAGG + Intronic
950433677 3:12966443-12966465 CCTTCTGAGGAGCAGGGGGGTGG - Intronic
952455556 3:33468369-33468391 CCTACCAAGGAGAATGGGGCAGG - Intergenic
952827670 3:37537657-37537679 CATTCTAGTGGGAGGGGGGCAGG + Intronic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
955312501 3:57903332-57903354 CATTCTAAAGAGAAGAGTGATGG + Intronic
959212735 3:103409746-103409768 CATTCTAGGCAGAAAGAGGCAGG + Intergenic
960403168 3:117228771-117228793 CATTCTAATGAGGAGGGAGTTGG + Intergenic
962235019 3:133700217-133700239 CATCCTAAGGAGGTGGGGGGTGG + Intergenic
963167521 3:142220616-142220638 CATTCTGAGGAGAAGGGTAGAGG - Intronic
963708827 3:148722535-148722557 CATTCTAAGAAGAGGCGGGAGGG + Intronic
963988863 3:151630037-151630059 CATTCTGAGTAGGACGGGGCAGG + Intergenic
964017731 3:151967712-151967734 CAATCTAAGGAGAATGGAACTGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076018 3:195816496-195816518 CCTTGTAAGGAGAAGGGCGGAGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968607940 4:1544396-1544418 CATTCTGAGGTGCTGGGGGCTGG - Intergenic
968663856 4:1810261-1810283 CACGCTGAGGAGGAGGGGGCTGG - Intergenic
970166231 4:13241270-13241292 CATTCTAAGGAGAAGAAGCAAGG - Intergenic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979628968 4:122879320-122879342 CATCCTAAAGTGAAAGGGGCAGG - Intronic
985048960 4:185970692-185970714 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
991153298 5:63398231-63398253 CATTCTATGGAGGAGGAGACTGG - Intergenic
994354519 5:98779982-98780004 CATGCAAAGTAGAAGGGGCCTGG + Exonic
995021980 5:107377400-107377422 CATACTAAGTAAAAGGGGGGTGG + Exonic
995833251 5:116376514-116376536 GATTCAAGGGAGCAGGGGGCAGG + Intronic
996731870 5:126724742-126724764 CATTCTCAGGAGAATGGACCAGG - Intergenic
997198339 5:131994467-131994489 GATTCTCAGGAAAAGTGGGCAGG - Intronic
997285649 5:132676367-132676389 GATTCTAAGAAGGAGGGGACCGG + Intronic
999324152 5:150632732-150632754 GATTCCAAGGGGAAGAGGGCAGG - Intronic
999677170 5:154015554-154015576 CATCCTTAGGAAAAGGGGGAAGG + Intronic
999717319 5:154371742-154371764 CAATGCAAGGAGAATGGGGCAGG - Intronic
1001565150 5:172695291-172695313 CATTGTCAGGAGGAGGGGGAGGG + Intergenic
1002437957 5:179244318-179244340 CATTATTAGGAGAAGTCGGCTGG - Intronic
1003328424 6:5110019-5110041 CACTTTAAAAAGAAGGGGGCAGG - Intronic
1003543967 6:7042749-7042771 CACTCTAAGGAGAGGGAGTCAGG - Intergenic
1006031293 6:31178469-31178491 CATTCTGAGAAGCAGGAGGCAGG + Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008052357 6:46913199-46913221 AGTTTTAAGAAGAAGGGGGCTGG + Intronic
1009909576 6:69909190-69909212 CTTTCTAAGGAAAAGAGGGTAGG + Intronic
1009936654 6:70242186-70242208 TATTCTCAGGAGAAGAGGGCGGG + Intronic
1012183596 6:96186435-96186457 CATACTAAGAAGAAGGCTGCAGG - Intronic
1013067807 6:106700458-106700480 CATTCAAGGGAGAAGGGCGAGGG - Intergenic
1013995666 6:116304775-116304797 CATTCTAGGCAGATGAGGGCTGG - Intronic
1014405637 6:121047145-121047167 CCTTTTAAGTAGAAAGGGGCAGG + Intergenic
1015565297 6:134563729-134563751 CAATCTAAGGTCAAGGAGGCTGG + Intergenic
1016546969 6:145234799-145234821 CATTCTAAGCATAAGAGGCCTGG - Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1019168956 6:170117807-170117829 CTTTCTCTGGAGAAGGGGTCAGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020679101 7:11214856-11214878 CATTCTGAAGAGAAGGGTGGTGG - Intergenic
1020954303 7:14720637-14720659 CATTTTAAAAAGAAAGGGGCCGG - Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023221580 7:37924415-37924437 CATTCTGAGTGGAAGGGGTCAGG - Intronic
1023327216 7:39073482-39073504 AATTCCAAGGAGATGGGGGTGGG - Intronic
1024560458 7:50640487-50640509 CCTTCTAAAGAGAAGGGTGGAGG - Intronic
1026617494 7:71918774-71918796 AATTCCAAGGAGCTGGGGGCTGG - Intronic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1028240965 7:88420161-88420183 CTTTCTAGGGAGAAGGGGAAAGG + Intergenic
1029479166 7:100802523-100802545 ATTTCTAAGGAGAGTGGGGCTGG - Intergenic
1031696123 7:124857347-124857369 AATTCTACGCAGAAGAGGGCAGG + Intronic
1032076938 7:128840529-128840551 CCCTCTGAGGAGATGGGGGCAGG - Exonic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1036140870 8:6206949-6206971 CATTCTAGGGAGACTGGGGTGGG + Intergenic
1036722040 8:11185089-11185111 CAGTCTAAGGACATGGGTGCGGG + Intronic
1036987582 8:13553962-13553984 AATACTAATGACAAGGGGGCAGG - Intergenic
1037027166 8:14053199-14053221 CATTCTGAGGAGCAGTGGGTGGG - Intergenic
1037293111 8:17372198-17372220 CATTTTTAGCAGAAGGTGGCAGG - Intronic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1037506059 8:19530801-19530823 CTTTCTAATGAGAAAGGGACTGG + Intronic
1037654750 8:20873289-20873311 CATGCTAAGGAGAGAGAGGCTGG - Intergenic
1037779311 8:21856766-21856788 CATCCTCAAGCGAAGGGGGCAGG + Intergenic
1039434020 8:37547297-37547319 CAAGCCAAGGAGGAGGGGGCTGG - Intergenic
1039661835 8:39476737-39476759 CATTGTAGGGAGAATTGGGCAGG - Intergenic
1041317818 8:56582538-56582560 CATTCTAAGGAAAGAGGGCCTGG + Intergenic
1042445955 8:68885191-68885213 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
1047023961 8:120807433-120807455 CATTTTAAGGAGTAGGGGCAGGG - Intronic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG + Intergenic
1051796446 9:20876855-20876877 AATTAAAAGGAGAAAGGGGCAGG - Intronic
1056059511 9:82869851-82869873 CATTCTAGGCAGACAGGGGCAGG + Intergenic
1059385328 9:113959903-113959925 CGTTTAAAGGAGAAGGGGGCCGG - Intronic
1059733988 9:117083655-117083677 CATTCTAAGGAAAGGCGGGTGGG + Intronic
1059776782 9:117484123-117484145 CATCCTAATTAGAAGTGGGCGGG + Intergenic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1062304947 9:135900395-135900417 CACTCTAAGAAAAAGAGGGCCGG + Intronic
1062532228 9:137007018-137007040 AAGGCTAAGGGGAAGGGGGCCGG + Intergenic
1203425349 Un_GL000195v1:32114-32136 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1186319802 X:8412242-8412264 CATTCTAAAGATAAAGGGCCGGG + Intergenic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1189906995 X:45771326-45771348 CATTCTAGGGAAAACGTGGCTGG - Intergenic
1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG + Intronic
1191057306 X:56254966-56254988 AATTCTAGGCAGAAGTGGGCAGG - Intronic
1191842539 X:65523559-65523581 CATCCGAAGGAGTTGGGGGCTGG + Exonic
1192581872 X:72289873-72289895 AATTTAAAGGAGGAGGGGGCCGG - Intronic
1195277872 X:103299790-103299812 GGTTCTCAGGAGAAGGCGGCTGG + Intergenic
1196948480 X:120851887-120851909 CATTCTAAGGAAAAGGAAACAGG + Intergenic
1199523883 X:148769763-148769785 CAAGTTAAGGAGAAGGGGTCTGG - Intronic
1200110420 X:153738027-153738049 CATGCCAGGGAGGAGGGGGCCGG + Intronic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic