ID: 965530471

View in Genome Browser
Species Human (GRCh38)
Location 3:169765546-169765568
Sequence TCCAGCCTCTCCTTGAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 278}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965530466_965530471 0 Left 965530466 3:169765523-169765545 CCCCTTCTCCTTAGAATGCCTTC 0: 1
1: 0
2: 1
3: 22
4: 270
Right 965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG 0: 1
1: 1
2: 2
3: 25
4: 278
965530464_965530471 5 Left 965530464 3:169765518-169765540 CCTGCCCCCTTCTCCTTAGAATG 0: 1
1: 0
2: 1
3: 13
4: 261
Right 965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG 0: 1
1: 1
2: 2
3: 25
4: 278
965530465_965530471 1 Left 965530465 3:169765522-169765544 CCCCCTTCTCCTTAGAATGCCTT 0: 1
1: 0
2: 2
3: 22
4: 301
Right 965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG 0: 1
1: 1
2: 2
3: 25
4: 278
965530468_965530471 -2 Left 965530468 3:169765525-169765547 CCTTCTCCTTAGAATGCCTTCTC 0: 1
1: 0
2: 4
3: 59
4: 481
Right 965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG 0: 1
1: 1
2: 2
3: 25
4: 278
965530467_965530471 -1 Left 965530467 3:169765524-169765546 CCCTTCTCCTTAGAATGCCTTCT 0: 1
1: 0
2: 3
3: 27
4: 398
Right 965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG 0: 1
1: 1
2: 2
3: 25
4: 278
965530462_965530471 10 Left 965530462 3:169765513-169765535 CCTACCCTGCCCCCTTCTCCTTA 0: 1
1: 0
2: 7
3: 86
4: 768
Right 965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG 0: 1
1: 1
2: 2
3: 25
4: 278
965530461_965530471 17 Left 965530461 3:169765506-169765528 CCGAGTTCCTACCCTGCCCCCTT 0: 1
1: 0
2: 3
3: 32
4: 438
Right 965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG 0: 1
1: 1
2: 2
3: 25
4: 278
965530469_965530471 -8 Left 965530469 3:169765531-169765553 CCTTAGAATGCCTTCTCCAGCCT 0: 1
1: 0
2: 2
3: 21
4: 351
Right 965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG 0: 1
1: 1
2: 2
3: 25
4: 278
965530463_965530471 6 Left 965530463 3:169765517-169765539 CCCTGCCCCCTTCTCCTTAGAAT 0: 1
1: 0
2: 1
3: 25
4: 302
Right 965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG 0: 1
1: 1
2: 2
3: 25
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965530471 Original CRISPR TCCAGCCTCTCCTTGAGCAG AGG Intergenic
900238368 1:1603205-1603227 TCCAACCTGTCCTGGAGCTGGGG - Intergenic
900874461 1:5331503-5331525 TCCAGATTCTCCTTGACAAGAGG + Intergenic
901400143 1:9010227-9010249 TCCAGGCTGTCCTTGTGGAGCGG - Exonic
901931416 1:12598114-12598136 TCCAGTCTCTACATGTGCAGGGG + Intronic
902458855 1:16555606-16555628 GGCACTCTCTCCTTGAGCAGGGG - Intergenic
902791123 1:18768942-18768964 TTCAGCCTCTCTTTCAGTAGTGG + Intergenic
902837779 1:19058077-19058099 TCCTGCCTTTCTCTGAGCAGGGG - Intergenic
903777820 1:25804608-25804630 TCCAGCCCCTCCTACAGCTGGGG + Intronic
904613624 1:31738390-31738412 TTTAGCCTGTCCTTGGGCAGTGG - Intronic
905449080 1:38045791-38045813 TCCAGCCACTTGTTGAGCAGCGG + Exonic
908362560 1:63383151-63383173 TCCAGCCTGTGCTGGAGCACAGG - Intronic
909593836 1:77381989-77382011 GGCAGCCTCTCCCTGTGCAGAGG - Intronic
913606792 1:120474779-120474801 GGCACTCTCTCCTTGAGCAGGGG + Intergenic
914209641 1:145565362-145565384 GGCACTCTCTCCTTGAGCAGGGG - Intergenic
914268561 1:146057731-146057753 GGCACTCTCTCCTTGAGCAGGGG - Intergenic
914368531 1:147003132-147003154 GGCACTCTCTCCTTGAGCAGGGG + Intergenic
914584401 1:149047057-149047079 GGCACTCTCTCCTTGAGCAGGGG - Intronic
919464302 1:197911882-197911904 TCCAGCCTCTCAATAATCAGAGG - Intronic
919741667 1:200984723-200984745 TCCAGCCCCTCCAAGAGCTGAGG - Intronic
920119284 1:203643642-203643664 TCCAGGCTCTCTTGGAACAGGGG + Intronic
922274899 1:224068417-224068439 TCCAGCCTGTCCTTGACCTCTGG + Intergenic
922783718 1:228272852-228272874 TCCACCCTGTCCCTGAGCTGGGG + Intronic
922807312 1:228397113-228397135 CCCAGCCTCTCCTGGAGGGGGGG - Intronic
923375846 1:233361932-233361954 TTCAGCTTCTCCTTGTGCACAGG + Intronic
1063145225 10:3289949-3289971 TCCAGCCACTCCCTCTGCAGGGG + Intergenic
1063450754 10:6148434-6148456 TCCAGCCTCACGCTGAGCATAGG - Intronic
1063841942 10:10082090-10082112 ACCAGCATCTCATTGAGGAGTGG + Intergenic
1063868103 10:10388999-10389021 TCCAGCCTCTTCTTGGGAATAGG + Intergenic
1064276848 10:13914084-13914106 GCCTTCCTCTTCTTGAGCAGAGG - Intronic
1068858255 10:61819687-61819709 TCCAGCCTCTCTTTCAGCTAGGG + Intergenic
1068910217 10:62372304-62372326 TCCATCCTCTCATTTAACAGGGG + Intergenic
1069517836 10:69093477-69093499 TCCAGCATCTTCTCCAGCAGAGG - Intronic
1072732017 10:97852657-97852679 TACAGCTTCTCCTAGAGCTGAGG - Intronic
1074433590 10:113414870-113414892 TCCATCCTCTCCAAGGGCAGTGG + Intergenic
1074549855 10:114432694-114432716 TCCAGCCTCTGCCTCAGAAGAGG + Intronic
1075057937 10:119233784-119233806 CCCAGGCTTTGCTTGAGCAGAGG + Intronic
1075337137 10:121616705-121616727 GCCAGCCTCAGCTTGAGAAGGGG - Intergenic
1075530810 10:123228040-123228062 TCCAGCCTCTGCTTGAGAGATGG + Intergenic
1076244961 10:128939567-128939589 TCCAGCCTCTCTTTGGTCAGTGG + Intergenic
1076667667 10:132102366-132102388 TCCAGCCCCTCCGTCTGCAGTGG + Intergenic
1076917198 10:133430205-133430227 GCAAGCATCTCCTTGAGCAGTGG - Intergenic
1076937293 10:133574964-133574986 GCAAGCATCTCCTTGAGCAGTGG - Intergenic
1077090224 11:775038-775060 TCCAGCCTCTCCTTCCCCACTGG - Intronic
1077907661 11:6546562-6546584 TCCAGTATCTGCTTGAGCAGTGG - Exonic
1079312961 11:19382303-19382325 TCCAGGCTCTCATTCAGCATGGG - Intronic
1079769998 11:24446583-24446605 TCCTGCCTCTCCCTGGGCAATGG + Intergenic
1084032508 11:66489217-66489239 TCCAGCCTCTCCTTGTCCCCTGG + Intronic
1084174130 11:67415013-67415035 TCCAGCCTCTCCTGGTGCGGTGG - Intronic
1084376007 11:68778129-68778151 TCCAGCCACTCCTTCAGCCAAGG - Intronic
1088437774 11:109834380-109834402 TCCAACCTCCCCTTCAGTAGAGG + Intergenic
1088667983 11:112113641-112113663 TCCAGTCTCTCCTTCACCGGAGG + Intronic
1089383970 11:118056143-118056165 TCCCGCCTCTCCTTGAGAAGCGG - Intergenic
1089748484 11:120633710-120633732 CCCAGCCTCTCCCTGCTCAGGGG - Intronic
1089775366 11:120831944-120831966 TCCCGGATCTCCTTGAGGAGCGG - Exonic
1090905937 11:131074511-131074533 ACCAACCTCTCCTGGAGCTGTGG - Intergenic
1091295517 11:134471566-134471588 TTCAGCCTCTCCATCTGCAGAGG + Intergenic
1091637682 12:2210039-2210061 TCGAGCCTCTCCTGGAGAAAAGG - Intronic
1091992381 12:4965887-4965909 TTCAGCTTTTCCTTCAGCAGTGG - Intergenic
1094746299 12:33348000-33348022 TCCCTCATTTCCTTGAGCAGTGG - Intergenic
1097029719 12:56081804-56081826 TCCAGCCCCTCCTCAACCAGAGG - Intronic
1097069423 12:56344001-56344023 TCCAGCCCTGCCTTCAGCAGTGG + Exonic
1097350510 12:58543612-58543634 TCCTGCCTGTCCCTGAGCAATGG - Intergenic
1097456097 12:59800397-59800419 TCCATTATTTCCTTGAGCAGTGG - Intergenic
1101434238 12:104651545-104651567 CTCAGCCTCTCCTTGACCTGGGG + Intronic
1103587731 12:121968566-121968588 TCCAGCCTCGCCTCAGGCAGAGG - Intronic
1103715505 12:122943103-122943125 TCCAGGCTGACCTTGAGCAATGG + Intronic
1104040906 12:125129877-125129899 TCCAGCATCTCCATGAGGACTGG - Intronic
1106201747 13:27543756-27543778 TGCAGCCCATGCTTGAGCAGTGG - Intergenic
1108140891 13:47419965-47419987 TCCAGCCTCTCTTTCAACTGTGG + Intergenic
1108836313 13:54554158-54554180 TTCTGCCTCTCCGTGAGCATGGG + Intergenic
1110399313 13:75071234-75071256 TCCTGCGTATCCTTGAGCACAGG + Intergenic
1113707066 13:112441862-112441884 AGCAGCGTCTCCTTGGGCAGAGG - Intergenic
1114196607 14:20483033-20483055 TAGAGCCCCTCCTTGGGCAGAGG - Intergenic
1118593896 14:67421338-67421360 AACAGCCTCTCCTTGAACATCGG + Intergenic
1122804408 14:104249337-104249359 TCCAGCCTCACCCTGAGCTGTGG - Intergenic
1123665548 15:22607669-22607691 CCTGGCCTCTCCTTGGGCAGAGG + Intergenic
1123752208 15:23364983-23365005 CCTGGCCTCTCCTTGGGCAGAGG - Exonic
1124319379 15:28702083-28702105 CCTGGCCTCTCCTTGGGCAGAGG + Exonic
1124483140 15:30093348-30093370 CCTGGCCTCTCCTTGGGCAGAGG - Exonic
1124489589 15:30145416-30145438 CCTGGCCTCTCCTTGGGCAGAGG - Exonic
1124520439 15:30403869-30403891 CCTGGCCTCTCCTTGGGCAGAGG + Exonic
1124538218 15:30562350-30562372 CCTGGCCTCTCCTTGGGCAGAGG - Exonic
1124544681 15:30614410-30614432 CCTGGCCTCTCCTTGGGCAGAGG - Exonic
1124753938 15:32392911-32392933 CCTGGCCTCTCCTTGGGCAGAGG + Exonic
1124760435 15:32445235-32445257 CCTGGCCTCTCCTTGGGCAGAGG + Exonic
1124778201 15:32603827-32603849 CCTGGCCTCTCCTTGGGCAGAGG - Exonic
1125326062 15:38537120-38537142 GACAGCCACTCCTTGAGTAGTGG - Intronic
1125416839 15:39462757-39462779 TCTAGCCTTTCCCTGAGAAGAGG + Intergenic
1128088987 15:64906167-64906189 TCCAACCTCACCTTCAGCTGTGG + Intronic
1128499635 15:68218812-68218834 TCCACCTTCTCCTTGACCACAGG - Intronic
1129189965 15:73931408-73931430 TACAGAATCTTCTTGAGCAGAGG - Intronic
1129225550 15:74168466-74168488 TCCATCTTCCCCTGGAGCAGAGG + Intergenic
1129460363 15:75697319-75697341 TCCAGACTGTCCTAGAGCAAAGG - Intronic
1129845351 15:78765524-78765546 TCTAGCCTCTCTTGGGGCAGGGG - Intronic
1130923017 15:88364983-88365005 TCCAGCCTCTGCTTGCCCTGTGG + Intergenic
1130993649 15:88891944-88891966 CCTAGAGTCTCCTTGAGCAGAGG + Intronic
1131049192 15:89334979-89335001 TCCACCTGCTCCTTGAGAAGGGG - Intergenic
1131184946 15:90265960-90265982 TCCTGCCGCTGCTTGCGCAGCGG + Intronic
1132775901 16:1593881-1593903 TGCAGCCTGTACTTGAGGAGTGG + Intronic
1133568488 16:7018256-7018278 TCCAGCTTCTCCTTATGCAAGGG + Intronic
1134164760 16:11921030-11921052 TCCAACCTCTCGGTGGGCAGAGG - Intergenic
1135770225 16:25212603-25212625 TCCAACCTTGCCTTGAGCAAGGG + Intergenic
1136228645 16:28874583-28874605 TCCAGCCTGGCTTTGAGAAGGGG - Intergenic
1136361459 16:29782661-29782683 CCCAGCCTCTTCTTTGGCAGGGG + Exonic
1136417412 16:30112540-30112562 TCCAGCTTCTCCTTGTAGAGGGG + Exonic
1136498135 16:30656225-30656247 TCCAGCCGCTGCTGGAGCAGGGG - Exonic
1136775511 16:32869746-32869768 TCCAGCCCCTCCCAGAGCTGAGG + Intergenic
1136895106 16:33991766-33991788 TCCAGCCCCTCCCAGAGCTGAGG - Intergenic
1137582358 16:49641005-49641027 TCCAGCCTGGCCTGGAGCGGGGG - Intronic
1137592544 16:49702582-49702604 TCCAGCCTCTCCTTGAGGGCTGG - Intronic
1138291733 16:55853827-55853849 TCCAGCATTTCCTAGAGCACCGG - Intronic
1138535430 16:57657480-57657502 TCAGGCCTCACCTGGAGCAGAGG - Exonic
1139126877 16:64088862-64088884 TGCAGCCTCTTCTTAAACAGTGG - Intergenic
1140194749 16:72846961-72846983 TGAAGCCTCTCCCTGAGAAGAGG + Intronic
1140725146 16:77805110-77805132 TCCAGCCTCTGATTGAACACAGG + Intronic
1142141756 16:88475758-88475780 CCCAGCCCCTCCCTAAGCAGAGG - Intronic
1203077929 16_KI270728v1_random:1131855-1131877 TCCAGCCCCTCCCAGAGCTGAGG + Intergenic
1142587189 17:980657-980679 TCCAGCTTCTCCCTAAGCATTGG - Intergenic
1143290512 17:5824417-5824439 TCAAGCCTCTCCTACAGCACAGG - Intronic
1143451590 17:7039930-7039952 TCCAGCCCCTCCTTGGGTAGGGG - Exonic
1143624256 17:8099947-8099969 CCCAGCCTCTCCTGTAGCTGAGG - Intronic
1144312785 17:14028245-14028267 CCCAGCTTCTCCATGAACAGTGG + Intergenic
1144331971 17:14233082-14233104 CCCAGCTTCTCCATGAACAGTGG - Intergenic
1145837896 17:27968526-27968548 ATCAGCCTTTGCTTGAGCAGAGG + Intergenic
1148565283 17:48628993-48629015 TCCAGCTTCTTCATGAGCAAAGG - Intronic
1148737936 17:49875342-49875364 ACCATCCTCTCCTTGAGGAATGG + Intergenic
1150266773 17:63837322-63837344 TCCAGGCTCTCCTGGGGGAGAGG - Intronic
1150476385 17:65479017-65479039 TCCTGCTTATCCTTGAGTAGTGG + Intergenic
1151425495 17:74028582-74028604 CCCAGCCTCCACTTGAGCACAGG - Intergenic
1151426224 17:74032673-74032695 TCCAGCCTCTCCATTTGTAGAGG + Intergenic
1152374722 17:79913211-79913233 TGCAGCCTCTCCATGAACACTGG - Intergenic
1152401434 17:80068907-80068929 TCTAGCCGGTCCCTGAGCAGGGG - Intronic
1152917695 17:83050698-83050720 TCCAGCCTCTGCCGGAGCACGGG + Intronic
1157806621 18:50663123-50663145 TGCAGCCTCTCTTGGTGCAGTGG + Exonic
1158663833 18:59414623-59414645 TTCATCCTCTCTTTGACCAGGGG - Intergenic
1160173452 18:76573189-76573211 TCCCGCTAGTCCTTGAGCAGGGG - Intergenic
1160768685 19:821083-821105 ACCAGCCTCACCATTAGCAGAGG + Intronic
1160870257 19:1274684-1274706 TCGAGTCTCTCCTGGAGCACGGG + Intronic
1161045110 19:2130422-2130444 TCCAGCTTCTCCTTCAGCCGGGG + Exonic
1161127509 19:2566605-2566627 TCTAGCCAGTCCTTTAGCAGTGG - Intronic
1161356065 19:3820207-3820229 TCCGGCCTGCCCATGAGCAGAGG + Exonic
1162136066 19:8555916-8555938 GCCAGCCTCTCCTGGAGATGGGG - Intronic
1162727995 19:12701365-12701387 GCCAGCCTCTCCTTGAGCAGCGG + Exonic
1164989264 19:32672942-32672964 TCCATCCTCTCATAGAGGAGTGG - Intronic
1166327353 19:42059413-42059435 TCACGGATCTCCTTGAGCAGTGG + Exonic
1166334239 19:42095801-42095823 TCAAGCCCCTCCTGGAGAAGTGG - Exonic
1168471424 19:56643483-56643505 TCCAGCCTCCTCGTGAGGAGGGG + Intronic
1202708679 1_KI270714v1_random:4527-4549 GGCACTCTCTCCTTGAGCAGTGG + Intergenic
925101927 2:1254262-1254284 TCCAGCATCTCCTGGTGCATGGG - Intronic
926103824 2:10137810-10137832 TCTAGCCTCTCCTCCAGAAGGGG + Intergenic
927390862 2:22593730-22593752 TCTATCATTTCCTTGAGCAGTGG - Intergenic
927757562 2:25721400-25721422 TCCACCCTCTCCTCGAACATGGG - Intergenic
928081753 2:28318228-28318250 TCCAGCCCTTCCTTGTACAGAGG - Intronic
928359688 2:30653108-30653130 TCCAGGCTCTCCCTGATCAGAGG + Intergenic
930203726 2:48568074-48568096 AACACCCTCTCCTTCAGCAGAGG - Intronic
930555250 2:52887007-52887029 TCCAGCCTCTGCATGAGGAACGG + Intergenic
932533429 2:72564126-72564148 TCGCTCCTCTTCTTGAGCAGAGG - Intronic
932574099 2:72953394-72953416 TTCAGCGTCTCCCAGAGCAGGGG - Intronic
933812294 2:86040334-86040356 CCTAGCCTCTCCTGGAGAAGGGG - Intronic
934655369 2:96114556-96114578 TCCACCCTCTCCCTGAGCACAGG - Exonic
935102017 2:100005415-100005437 TCCGGCATATCTTTGAGCAGTGG - Intronic
935592818 2:104856642-104856664 TCCAGCCACTTGTTCAGCAGCGG - Exonic
937203155 2:120218679-120218701 TCCAGCCCCTCAGTTAGCAGTGG - Intergenic
938004422 2:127776410-127776432 TCCTGACTCTCCTTCAACAGAGG + Intronic
940901874 2:159133147-159133169 TACAGGCACTTCTTGAGCAGTGG + Intronic
942415720 2:175757237-175757259 TCCTGCCTCACCTTTATCAGTGG + Intergenic
946171705 2:217899582-217899604 TTCAGCCTCTCCCTCAGCACAGG + Intronic
946257379 2:218454844-218454866 TCCAAATTCTCCTTCAGCAGAGG + Exonic
947910375 2:233796560-233796582 TCCAGCCTCTGATTGAGCTTTGG - Intronic
948540591 2:238689101-238689123 TCCAGCTCCTCGTTGAGCAGTGG - Intergenic
1168888170 20:1274934-1274956 TCCAGCCTCCCTTTCAGAAGTGG + Intronic
1171146481 20:22788221-22788243 TCAAGCCCCTCCCTGAGCACAGG - Intergenic
1171456378 20:25275036-25275058 TCCTGCCTGCCCTTAAGCAGCGG - Intronic
1172117745 20:32582595-32582617 TCCACCCTCTCCTGGAGTTGGGG - Intronic
1172151931 20:32796829-32796851 TCCACCCTCTCTTTGAGGGGGGG + Exonic
1172487533 20:35307322-35307344 CCCAGCCTCTCCCTAAGTAGGGG + Intronic
1175309004 20:57998488-57998510 AACAGCGTCTCCTTGAGCACCGG + Intergenic
1175972770 20:62695253-62695275 TCCAGGGCCTCCTTGAGCAACGG + Intergenic
1178304717 21:31481879-31481901 TCCATCCTCTCCTTAGGGAGAGG - Intronic
1179329746 21:40388056-40388078 TCTACCCTCTCCTTGAACTGTGG - Intronic
1181314281 22:21961684-21961706 TCCAGGCTCTGCTCCAGCAGTGG - Intronic
1181653035 22:24271325-24271347 CCCAGCCTCTCCCGGAGCGGCGG - Intronic
1181876228 22:25943034-25943056 CCCAGCCCCTACTTCAGCAGAGG - Intronic
1182297600 22:29318801-29318823 TGCATCTTCTCCTTCAGCAGAGG + Intronic
1182426936 22:30278554-30278576 CCCTGCCTCTCCCTGATCAGGGG - Intergenic
1182702254 22:32250013-32250035 TCCAGCCCATCCTTTAGCACAGG - Intronic
1183023799 22:35048729-35048751 TTCGGCCTCTCTTTGGGCAGAGG - Intergenic
1183619417 22:38964087-38964109 CCCAGCCCCGCCCTGAGCAGAGG + Intronic
1183730657 22:39616853-39616875 CCCAGCCTATCCTGGGGCAGGGG + Intronic
1184039714 22:41935589-41935611 GCCAGCCTCTGCTTGAGGAGGGG - Intergenic
1184827639 22:46963819-46963841 TCCAGCCTTTGCCTCAGCAGTGG + Intronic
949797512 3:7867142-7867164 TCAAGCCTATTCTTAAGCAGAGG - Intergenic
949876853 3:8631895-8631917 TCCATCCTCTCATTTTGCAGGGG + Intronic
950063971 3:10096359-10096381 TCCAGGGTCTTTTTGAGCAGAGG - Exonic
952487391 3:33827778-33827800 TCCAGCCTTACCTTGAGAACTGG + Intronic
953992612 3:47495839-47495861 TCCAGCCTCTCTCTCAGCAAAGG + Exonic
954848887 3:53583528-53583550 TCCAGCCCCTCCTTGACCTGAGG + Intronic
955550284 3:60077317-60077339 TTCAGCCTCTCTGTGAGTAGAGG - Intronic
960582561 3:119293767-119293789 TGCAGCCTCTCTTTGCCCAGGGG + Intergenic
961205268 3:125076546-125076568 TCCATCCTTTCCATGAGTAGAGG - Intergenic
961333482 3:126156545-126156567 GCCAGCCTGTCCTCGGGCAGGGG + Intronic
962372351 3:134831227-134831249 TCTAACCTGTCCTGGAGCAGAGG + Intronic
963083602 3:141416810-141416832 TCCAGTCTCTCCTTGGCCTGTGG - Intronic
965530471 3:169765546-169765568 TCCAGCCTCTCCTTGAGCAGAGG + Intergenic
965961374 3:174432065-174432087 TCCAGCCTATCCTTGAGGGGAGG + Intergenic
967224878 3:187281781-187281803 TCCATCCTCTCACTGAACAGAGG + Intronic
968337617 3:197926802-197926824 TCCAGCCTCTCCTTCACTGGGGG + Intronic
968445492 4:650200-650222 TCCAGCCACACCTTGAAAAGGGG + Intronic
971677360 4:29649701-29649723 TTCAGTCTGTCCTTGAGCAAAGG - Intergenic
971910434 4:32789086-32789108 CCCAGCCCTTCCTTAAGCAGAGG + Intergenic
973155407 4:46945388-46945410 ACCTGCCTCTCCTGGAGCAAAGG + Intronic
973823741 4:54685083-54685105 TCCTGGTTCTCCTTTAGCAGTGG + Intronic
975650785 4:76590562-76590584 TCCTGATTCTTCTTGAGCAGTGG - Intronic
976918154 4:90404313-90404335 CTCAGCCTCTCCTTGGGCAGCGG - Intronic
980147129 4:129001215-129001237 CCCAGATTCTCCTAGAGCAGTGG + Intronic
980820724 4:138012953-138012975 TCCTGCCTCTCTTTGAGGAGTGG + Intergenic
981587266 4:146317715-146317737 TCCATCTTCTCCTTGAACACTGG + Intronic
982119234 4:152124914-152124936 TCTACCCTATCCTTGAGCATGGG + Intergenic
983911650 4:173246475-173246497 TCCTGCCTTTCCTTCTGCAGGGG - Intronic
985539661 5:482075-482097 TGCAGCTTCTCGTTGAGCCGAGG + Exonic
987610040 5:20191310-20191332 TCCTGCTTCTCCTTCAGCTGGGG + Intronic
994310131 5:98259714-98259736 TCTCTCCTCTCCTTAAGCAGAGG + Intergenic
997102820 5:130987573-130987595 TCCTGCCTCTCTTTGACCTGAGG - Intergenic
998062932 5:139133302-139133324 TCCAACCTCTATTTAAGCAGAGG - Intronic
999474000 5:151881440-151881462 TCCAGCTACTCCTGGAGCAGGGG - Intronic
1000478701 5:161744570-161744592 TCCCTCCTCTCCTCAAGCAGAGG + Intergenic
1001834983 5:174824239-174824261 TCCGGCCTATCCTTCAGCACTGG - Intergenic
1001999871 5:176191630-176191652 TCCAGCCTGACACTGAGCAGAGG - Intergenic
1002774218 6:315015-315037 CCCAGCCACTCCCTGACCAGAGG - Intronic
1003722400 6:8718330-8718352 GCCAACCTCTCCTTTAGCAGAGG + Intergenic
1004211644 6:13652061-13652083 TCAAGTCTCACCTTGAGCAAAGG + Intronic
1004289259 6:14351486-14351508 TCCAGACTCGCCTTGACTAGTGG - Intergenic
1005791827 6:29310772-29310794 TGCCCTCTCTCCTTGAGCAGTGG + Intergenic
1006057400 6:31395702-31395724 TCCAGCCTCTCCCTCAGCGCTGG - Intergenic
1006794285 6:36722010-36722032 TCCAGCCTCTCTGTGGGCACCGG - Exonic
1007740936 6:44009150-44009172 GCCAGGCCCTCCTGGAGCAGTGG + Intergenic
1011630495 6:89319003-89319025 TCCTGCCAATCCTTGAGCATGGG - Intergenic
1014317103 6:119881598-119881620 TCCAGCCTCTCTTTCTGCACTGG + Intergenic
1014761730 6:125363959-125363981 TCCAGCCTCTCCTGAAAGAGGGG - Intergenic
1014961318 6:127688930-127688952 TTCATCCTCTCCATGAGCATGGG + Intergenic
1015441114 6:133247741-133247763 TCCTGCTTCACCTAGAGCAGTGG - Intronic
1017615897 6:156246063-156246085 TCCAGCCTATACTTGAGGAAAGG - Intergenic
1017638456 6:156466517-156466539 TCCAGCCTCTTCTTCAGCAGGGG - Intergenic
1018291509 6:162296341-162296363 TCCATCCTCTCCTGCAGTAGAGG - Intronic
1018472504 6:164109247-164109269 TCCAACCTTTCATAGAGCAGTGG - Intergenic
1018513792 6:164555850-164555872 TCCAGCCTCTTCTTCCCCAGGGG + Intergenic
1018810438 6:167294604-167294626 CCCAGCCTCTCGATGAGGAGCGG - Exonic
1019103020 6:169647363-169647385 TCCAGCCCATCCATGAGCAGAGG + Intronic
1019134377 6:169899129-169899151 TCCAGCCTCTCCTTCCTCTGAGG + Intergenic
1019612228 7:1942312-1942334 TCCTGTCTCACCTGGAGCAGAGG - Intronic
1019944528 7:4316081-4316103 TCCGGCCTCTCCTTCAACACTGG + Intergenic
1020454558 7:8356942-8356964 TCCACCCTCTCCTTCTACAGTGG + Intergenic
1021731095 7:23596729-23596751 TCCAGCCTCTCGGGGAGCTGAGG - Intergenic
1021923608 7:25513036-25513058 TCCAGCCTCTCCAGCAGGAGGGG - Intergenic
1022510722 7:30933427-30933449 GGCAGCCTCTCCTTGTGCTGAGG + Intergenic
1022705137 7:32795243-32795265 TCCAGCCTCCCCATTAGCTGGGG + Intergenic
1022904181 7:34840028-34840050 TCCTGCTTCTGCTTGAGCTGAGG + Intronic
1024186079 7:46949409-46949431 TCCAACCTCACCTCCAGCAGAGG + Intergenic
1024211603 7:47210771-47210793 TCCAGGCACTGCTTGAACAGTGG - Intergenic
1025178054 7:56811773-56811795 TCCAGCCTCTACCTCAACAGTGG - Intergenic
1029195029 7:98799409-98799431 TCCAGCATCTCCATGAGCCTAGG + Intergenic
1030269373 7:107654036-107654058 TGCAGCCTATGCTTGAGGAGTGG - Intergenic
1032013251 7:128360278-128360300 CCCAGCTTCTGCATGAGCAGAGG - Intronic
1035167847 7:157002388-157002410 TCCAGCCCCTCCTGGAGCTCCGG - Intronic
1035754833 8:2023334-2023356 CCCAGCCTCTTTCTGAGCAGTGG - Intergenic
1036227045 8:6968236-6968258 TCAAGCCTCTCCCTGAGCCTGGG + Intergenic
1037262838 8:17027341-17027363 ACCAGCCCCTCCTTGGGCCGTGG + Exonic
1038450551 8:27636568-27636590 TCCAGGCTCTCCTTGTGCTGTGG + Intronic
1040275334 8:46010926-46010948 TCCACCCACACCTTGTGCAGGGG + Intergenic
1041374522 8:57200051-57200073 TCCTGCCTGTCCTTGGGCAATGG - Intergenic
1042444298 8:68866249-68866271 TCCAGCCTATTCTAGATCAGTGG + Intergenic
1042776452 8:72437284-72437306 TCCAGCTTCTTCCTGAGCTGGGG + Intergenic
1045186907 8:99847553-99847575 TACAGCCTCTGCTTCAGCTGAGG - Intronic
1045413483 8:101943553-101943575 CCCAGTCACTCCTGGAGCAGGGG + Intronic
1045865720 8:106863260-106863282 TCAATCCTCTACTTGAGCATTGG - Intergenic
1047616117 8:126563834-126563856 TCCAGCCTCTCCCCTTGCAGTGG - Intergenic
1048307157 8:133292491-133292513 CCCAGCCTCCCCTCCAGCAGAGG + Intronic
1048564400 8:135580138-135580160 CCCAGCCTATTCTTGAGCACTGG - Intronic
1049394530 8:142393668-142393690 TCCACCACCTCCTGGAGCAGAGG + Intronic
1049834697 8:144727477-144727499 TGCAGCTTCTCCATCAGCAGTGG + Intronic
1053057009 9:34999099-34999121 TTCAGCCTCGCCAGGAGCAGTGG - Intergenic
1054322220 9:63682057-63682079 TCCTGCCTGTCCTTGGGCAATGG - Intergenic
1054773514 9:69105294-69105316 TCCACCTTCTCTCTGAGCAGTGG - Intergenic
1055429874 9:76232454-76232476 TCCAGACTGTCACTGAGCAGCGG + Intronic
1058003476 9:99890951-99890973 TCCAGCCTCGCCAGGTGCAGTGG - Intergenic
1058797403 9:108512082-108512104 TCCAGCCTCACACTGAGCCGGGG + Intergenic
1059598756 9:115752871-115752893 TTCAGCCCGTCCTGGAGCAGAGG - Intergenic
1059840175 9:118206149-118206171 TCCACCCTCTCCAGGAGTAGGGG + Intergenic
1061624887 9:131835759-131835781 CCCAGCACCTCCTTCAGCAGAGG - Intergenic
1186664377 X:11703253-11703275 TCCTGCCCTTCCTGGAGCAGAGG - Intergenic
1189355996 X:40310273-40310295 TCCAGGCTCCCCTGCAGCAGGGG + Intergenic
1190713002 X:53082823-53082845 TCCAGGCTCTCCGTGGGCGGGGG - Exonic
1191841246 X:65514849-65514871 ACCAGCCTGTGCTAGAGCAGCGG - Exonic
1193244874 X:79216151-79216173 TCCCTTATCTCCTTGAGCAGTGG + Intergenic
1193601107 X:83509072-83509094 TCCAGCCACTTGTTCAGCAGGGG - Exonic
1195404628 X:104499470-104499492 TCCAGTCTAACCTTGAGCAGAGG + Intergenic
1197039121 X:121913892-121913914 TCCAGCCTCTTGCTGAGCTGGGG + Intergenic
1197447711 X:126571729-126571751 TCCAGCCCCTGCCAGAGCAGCGG + Intergenic
1197720884 X:129743843-129743865 CCCAGCCTCTCCTGAAGCAGCGG - Intronic
1197978389 X:132189853-132189875 TCCAGCCTCTCCAAGAAGAGGGG + Intergenic
1201641569 Y:16183750-16183772 TCTTGACTCTCCTTGATCAGAGG - Intergenic
1201661246 Y:16401572-16401594 TCTTGACTCTCCTTGATCAGAGG + Intergenic
1202119517 Y:21509092-21509114 TCCGGCGGCTCCTTGACCAGAGG - Intergenic
1202121969 Y:21532632-21532654 TCCGGCGGCTCCTTGACCAGAGG - Intronic
1202157037 Y:21896750-21896772 TCCGGCGGCTCCTTGACCAGAGG + Intronic
1202159483 Y:21920291-21920313 TCCGGCGGCTCCTTGACCAGAGG + Intergenic
1202205430 Y:22401190-22401212 TCCGGCGGCTCCTTGACCAGAGG - Intronic