ID: 965535362

View in Genome Browser
Species Human (GRCh38)
Location 3:169818169-169818191
Sequence AGGGAGAGGAAAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965535362_965535370 14 Left 965535362 3:169818169-169818191 CCCACAGTCACTTTCCTCTCCCT No data
Right 965535370 3:169818206-169818228 TATTCTCTCTCTGTGCCACATGG No data
965535362_965535372 24 Left 965535362 3:169818169-169818191 CCCACAGTCACTTTCCTCTCCCT No data
Right 965535372 3:169818216-169818238 CTGTGCCACATGGCTGCTCTGGG No data
965535362_965535376 30 Left 965535362 3:169818169-169818191 CCCACAGTCACTTTCCTCTCCCT No data
Right 965535376 3:169818222-169818244 CACATGGCTGCTCTGGGGGTTGG No data
965535362_965535374 26 Left 965535362 3:169818169-169818191 CCCACAGTCACTTTCCTCTCCCT No data
Right 965535374 3:169818218-169818240 GTGCCACATGGCTGCTCTGGGGG No data
965535362_965535373 25 Left 965535362 3:169818169-169818191 CCCACAGTCACTTTCCTCTCCCT No data
Right 965535373 3:169818217-169818239 TGTGCCACATGGCTGCTCTGGGG No data
965535362_965535371 23 Left 965535362 3:169818169-169818191 CCCACAGTCACTTTCCTCTCCCT No data
Right 965535371 3:169818215-169818237 TCTGTGCCACATGGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965535362 Original CRISPR AGGGAGAGGAAAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr