ID: 965542755

View in Genome Browser
Species Human (GRCh38)
Location 3:169886881-169886903
Sequence CAGAGATTCCTAAAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965542755_965542759 12 Left 965542755 3:169886881-169886903 CCAGGACACTTTAGGAATCTCTG No data
Right 965542759 3:169886916-169886938 CAAACTCTTGGCAGGAAACCAGG No data
965542755_965542756 0 Left 965542755 3:169886881-169886903 CCAGGACACTTTAGGAATCTCTG No data
Right 965542756 3:169886904-169886926 CTGTGCTCATGCCAAACTCTTGG No data
965542755_965542760 16 Left 965542755 3:169886881-169886903 CCAGGACACTTTAGGAATCTCTG No data
Right 965542760 3:169886920-169886942 CTCTTGGCAGGAAACCAGGCTGG No data
965542755_965542761 17 Left 965542755 3:169886881-169886903 CCAGGACACTTTAGGAATCTCTG No data
Right 965542761 3:169886921-169886943 TCTTGGCAGGAAACCAGGCTGGG No data
965542755_965542762 26 Left 965542755 3:169886881-169886903 CCAGGACACTTTAGGAATCTCTG No data
Right 965542762 3:169886930-169886952 GAAACCAGGCTGGGCGCTCCAGG No data
965542755_965542757 4 Left 965542755 3:169886881-169886903 CCAGGACACTTTAGGAATCTCTG No data
Right 965542757 3:169886908-169886930 GCTCATGCCAAACTCTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965542755 Original CRISPR CAGAGATTCCTAAAGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr