ID: 965542759

View in Genome Browser
Species Human (GRCh38)
Location 3:169886916-169886938
Sequence CAAACTCTTGGCAGGAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965542755_965542759 12 Left 965542755 3:169886881-169886903 CCAGGACACTTTAGGAATCTCTG No data
Right 965542759 3:169886916-169886938 CAAACTCTTGGCAGGAAACCAGG No data
965542753_965542759 24 Left 965542753 3:169886869-169886891 CCTGGTCTGGGGCCAGGACACTT No data
Right 965542759 3:169886916-169886938 CAAACTCTTGGCAGGAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965542759 Original CRISPR CAAACTCTTGGCAGGAAACC AGG Intergenic
No off target data available for this crispr