ID: 965542761

View in Genome Browser
Species Human (GRCh38)
Location 3:169886921-169886943
Sequence TCTTGGCAGGAAACCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965542753_965542761 29 Left 965542753 3:169886869-169886891 CCTGGTCTGGGGCCAGGACACTT No data
Right 965542761 3:169886921-169886943 TCTTGGCAGGAAACCAGGCTGGG No data
965542755_965542761 17 Left 965542755 3:169886881-169886903 CCAGGACACTTTAGGAATCTCTG No data
Right 965542761 3:169886921-169886943 TCTTGGCAGGAAACCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965542761 Original CRISPR TCTTGGCAGGAAACCAGGCT GGG Intergenic
No off target data available for this crispr