ID: 965542762

View in Genome Browser
Species Human (GRCh38)
Location 3:169886930-169886952
Sequence GAAACCAGGCTGGGCGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965542758_965542762 -8 Left 965542758 3:169886915-169886937 CCAAACTCTTGGCAGGAAACCAG No data
Right 965542762 3:169886930-169886952 GAAACCAGGCTGGGCGCTCCAGG No data
965542755_965542762 26 Left 965542755 3:169886881-169886903 CCAGGACACTTTAGGAATCTCTG No data
Right 965542762 3:169886930-169886952 GAAACCAGGCTGGGCGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965542762 Original CRISPR GAAACCAGGCTGGGCGCTCC AGG Intergenic
No off target data available for this crispr