ID: 965543161

View in Genome Browser
Species Human (GRCh38)
Location 3:169890420-169890442
Sequence TCAGAGGACAAAAGCGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965543161_965543167 27 Left 965543161 3:169890420-169890442 CCACCATCGCTTTTGTCCTCTGA No data
Right 965543167 3:169890470-169890492 CGAGCTCTGAGGGCTTTTCCAGG No data
965543161_965543165 17 Left 965543161 3:169890420-169890442 CCACCATCGCTTTTGTCCTCTGA No data
Right 965543165 3:169890460-169890482 TCTAATACCTCGAGCTCTGAGGG No data
965543161_965543164 16 Left 965543161 3:169890420-169890442 CCACCATCGCTTTTGTCCTCTGA No data
Right 965543164 3:169890459-169890481 TTCTAATACCTCGAGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965543161 Original CRISPR TCAGAGGACAAAAGCGATGG TGG (reversed) Intergenic
No off target data available for this crispr