ID: 965543162

View in Genome Browser
Species Human (GRCh38)
Location 3:169890423-169890445
Sequence ATGTCAGAGGACAAAAGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965543162_965543167 24 Left 965543162 3:169890423-169890445 CCATCGCTTTTGTCCTCTGACAT No data
Right 965543167 3:169890470-169890492 CGAGCTCTGAGGGCTTTTCCAGG No data
965543162_965543164 13 Left 965543162 3:169890423-169890445 CCATCGCTTTTGTCCTCTGACAT No data
Right 965543164 3:169890459-169890481 TTCTAATACCTCGAGCTCTGAGG No data
965543162_965543165 14 Left 965543162 3:169890423-169890445 CCATCGCTTTTGTCCTCTGACAT No data
Right 965543165 3:169890460-169890482 TCTAATACCTCGAGCTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965543162 Original CRISPR ATGTCAGAGGACAAAAGCGA TGG (reversed) Intergenic