ID: 965543163

View in Genome Browser
Species Human (GRCh38)
Location 3:169890436-169890458
Sequence TGTTTTAGTTGCAATGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965543163_965543171 29 Left 965543163 3:169890436-169890458 CCTCTGACATTGCAACTAAAACA No data
Right 965543171 3:169890488-169890510 CCAGGTGTATTCATTTTCTGGGG No data
965543163_965543167 11 Left 965543163 3:169890436-169890458 CCTCTGACATTGCAACTAAAACA No data
Right 965543167 3:169890470-169890492 CGAGCTCTGAGGGCTTTTCCAGG No data
965543163_965543165 1 Left 965543163 3:169890436-169890458 CCTCTGACATTGCAACTAAAACA No data
Right 965543165 3:169890460-169890482 TCTAATACCTCGAGCTCTGAGGG No data
965543163_965543168 27 Left 965543163 3:169890436-169890458 CCTCTGACATTGCAACTAAAACA No data
Right 965543168 3:169890486-169890508 TTCCAGGTGTATTCATTTTCTGG No data
965543163_965543164 0 Left 965543163 3:169890436-169890458 CCTCTGACATTGCAACTAAAACA No data
Right 965543164 3:169890459-169890481 TTCTAATACCTCGAGCTCTGAGG No data
965543163_965543169 28 Left 965543163 3:169890436-169890458 CCTCTGACATTGCAACTAAAACA No data
Right 965543169 3:169890487-169890509 TCCAGGTGTATTCATTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965543163 Original CRISPR TGTTTTAGTTGCAATGTCAG AGG (reversed) Intergenic
No off target data available for this crispr