ID: 965543165 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:169890460-169890482 |
Sequence | TCTAATACCTCGAGCTCTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
965543163_965543165 | 1 | Left | 965543163 | 3:169890436-169890458 | CCTCTGACATTGCAACTAAAACA | No data | ||
Right | 965543165 | 3:169890460-169890482 | TCTAATACCTCGAGCTCTGAGGG | No data | ||||
965543161_965543165 | 17 | Left | 965543161 | 3:169890420-169890442 | CCACCATCGCTTTTGTCCTCTGA | No data | ||
Right | 965543165 | 3:169890460-169890482 | TCTAATACCTCGAGCTCTGAGGG | No data | ||||
965543162_965543165 | 14 | Left | 965543162 | 3:169890423-169890445 | CCATCGCTTTTGTCCTCTGACAT | No data | ||
Right | 965543165 | 3:169890460-169890482 | TCTAATACCTCGAGCTCTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
965543165 | Original CRISPR | TCTAATACCTCGAGCTCTGA GGG | Intergenic | ||