ID: 965543165

View in Genome Browser
Species Human (GRCh38)
Location 3:169890460-169890482
Sequence TCTAATACCTCGAGCTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965543163_965543165 1 Left 965543163 3:169890436-169890458 CCTCTGACATTGCAACTAAAACA No data
Right 965543165 3:169890460-169890482 TCTAATACCTCGAGCTCTGAGGG No data
965543161_965543165 17 Left 965543161 3:169890420-169890442 CCACCATCGCTTTTGTCCTCTGA No data
Right 965543165 3:169890460-169890482 TCTAATACCTCGAGCTCTGAGGG No data
965543162_965543165 14 Left 965543162 3:169890423-169890445 CCATCGCTTTTGTCCTCTGACAT No data
Right 965543165 3:169890460-169890482 TCTAATACCTCGAGCTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965543165 Original CRISPR TCTAATACCTCGAGCTCTGA GGG Intergenic
No off target data available for this crispr