ID: 965543167

View in Genome Browser
Species Human (GRCh38)
Location 3:169890470-169890492
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965543162_965543167 24 Left 965543162 3:169890423-169890445 CCATCGCTTTTGTCCTCTGACAT No data
Right 965543167 3:169890470-169890492 CGAGCTCTGAGGGCTTTTCCAGG No data
965543163_965543167 11 Left 965543163 3:169890436-169890458 CCTCTGACATTGCAACTAAAACA No data
Right 965543167 3:169890470-169890492 CGAGCTCTGAGGGCTTTTCCAGG No data
965543161_965543167 27 Left 965543161 3:169890420-169890442 CCACCATCGCTTTTGTCCTCTGA No data
Right 965543167 3:169890470-169890492 CGAGCTCTGAGGGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type