ID: 965543169

View in Genome Browser
Species Human (GRCh38)
Location 3:169890487-169890509
Sequence TCCAGGTGTATTCATTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965543166_965543169 -3 Left 965543166 3:169890467-169890489 CCTCGAGCTCTGAGGGCTTTTCC No data
Right 965543169 3:169890487-169890509 TCCAGGTGTATTCATTTTCTGGG No data
965543163_965543169 28 Left 965543163 3:169890436-169890458 CCTCTGACATTGCAACTAAAACA No data
Right 965543169 3:169890487-169890509 TCCAGGTGTATTCATTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965543169 Original CRISPR TCCAGGTGTATTCATTTTCT GGG Intergenic
No off target data available for this crispr