ID: 965550770

View in Genome Browser
Species Human (GRCh38)
Location 3:169962818-169962840
Sequence GTCCTAGGAAACCATACTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965550770_965550778 29 Left 965550770 3:169962818-169962840 CCTTAAGTATGGTTTCCTAGGAC No data
Right 965550778 3:169962870-169962892 CATGCCGTTTTTGGTCAAAGTGG No data
965550770_965550777 20 Left 965550770 3:169962818-169962840 CCTTAAGTATGGTTTCCTAGGAC No data
Right 965550777 3:169962861-169962883 CTTCTTCTTCATGCCGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965550770 Original CRISPR GTCCTAGGAAACCATACTTA AGG (reversed) Intergenic
No off target data available for this crispr