ID: 965550775

View in Genome Browser
Species Human (GRCh38)
Location 3:169962850-169962872
Sequence ATGAAGAAGAAGAAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965550775_965550778 -3 Left 965550775 3:169962850-169962872 CCTTGCTCCTTCTTCTTCTTCAT No data
Right 965550778 3:169962870-169962892 CATGCCGTTTTTGGTCAAAGTGG No data
965550775_965550780 12 Left 965550775 3:169962850-169962872 CCTTGCTCCTTCTTCTTCTTCAT No data
Right 965550780 3:169962885-169962907 CAAAGTGGATCTCCTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965550775 Original CRISPR ATGAAGAAGAAGAAGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr