ID: 965551147

View in Genome Browser
Species Human (GRCh38)
Location 3:169966634-169966656
Sequence CAGCAGGAGCGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 816
Summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 739}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965551138_965551147 1 Left 965551138 3:169966610-169966632 CCTAACGATTCTCCAGTTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG 0: 1
1: 0
2: 5
3: 71
4: 739
965551135_965551147 24 Left 965551135 3:169966587-169966609 CCACTTCTCTGCTTCCTCCACGT 0: 1
1: 0
2: 3
3: 82
4: 746
Right 965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG 0: 1
1: 0
2: 5
3: 71
4: 739
965551136_965551147 10 Left 965551136 3:169966601-169966623 CCTCCACGTCCTAACGATTCTCC 0: 1
1: 0
2: 0
3: 57
4: 1028
Right 965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG 0: 1
1: 0
2: 5
3: 71
4: 739
965551137_965551147 7 Left 965551137 3:169966604-169966626 CCACGTCCTAACGATTCTCCAGT 0: 1
1: 0
2: 0
3: 13
4: 387
Right 965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG 0: 1
1: 0
2: 5
3: 71
4: 739

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965551147 Original CRISPR CAGCAGGAGCGGAGGGAAGA GGG Intronic
900391497 1:2435937-2435959 GAGGAGGAGAGGAGGGAGGAAGG - Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
900932793 1:5747511-5747533 CAGCAGGAAGGGAGGAAGGAGGG + Intergenic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
901451219 1:9338031-9338053 CAGCTGGGGTGCAGGGAAGAGGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901756337 1:11443773-11443795 CACCAGGAGGGGTGGGATGATGG - Intergenic
901882824 1:12204108-12204130 CAGAAGGGGCAGAGGGGAGAGGG - Intronic
902121455 1:14169491-14169513 CAACTGGAGTGGAGTGAAGAGGG + Intergenic
902611891 1:17602575-17602597 CAGCAGGGGTGGGGGAAAGAGGG + Intronic
903917326 1:26773893-26773915 CAGCAGGTGAGGAGGGTAGCTGG + Exonic
904040308 1:27580422-27580444 GAGCAGGAGAAAAGGGAAGAGGG - Intronic
904042798 1:27593960-27593982 CAGCAAGAGAGGAGGCACGAGGG + Intronic
904304083 1:29575797-29575819 CTGGAGGAGGGCAGGGAAGAGGG - Intergenic
904534461 1:31190081-31190103 CAACAGAAGAGGAGAGAAGAGGG + Intronic
904538391 1:31216246-31216268 GAGCAGGAGTGGAGCGAGGAGGG + Intronic
904542131 1:31240012-31240034 CCGCCGGAGGGGAGGGGAGAGGG + Intergenic
904750823 1:32740849-32740871 CAGCGGGAGAGGAGCCAAGATGG - Intergenic
905052090 1:35060616-35060638 CAGCAGGAGAGGAGGGGCGAAGG - Intronic
905106281 1:35565439-35565461 CAGCGGGAGCGCAGGGCAGCGGG - Exonic
905276711 1:36823110-36823132 CACCAGGAGTGAAGGGGAGATGG + Intronic
906149098 1:43577454-43577476 CAGCTGGAGGTGAAGGAAGAGGG - Intronic
906231002 1:44164307-44164329 CAGCAGTAAGGAAGGGAAGATGG + Intergenic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907393671 1:54175020-54175042 CAGCAGAGGCACAGGGAAGAGGG + Intronic
908321952 1:62987093-62987115 CAGCAGGAACAGAGGGGAAAAGG - Intergenic
908481983 1:64549671-64549693 CAGCAGGATGGAAAGGAAGAAGG + Intronic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911685565 1:100773046-100773068 CACCAGGGGCTAAGGGAAGAAGG - Intergenic
912322547 1:108727781-108727803 AAGCAGGAGCAGAGGGAAAATGG - Intronic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
917017003 1:170543424-170543446 GGGCAGGAGAAGAGGGAAGAAGG + Intronic
917562032 1:176168479-176168501 AGGCAGGAAGGGAGGGAAGAAGG + Intronic
917748586 1:178034702-178034724 CACCAGGTGTGAAGGGAAGATGG + Intergenic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
919742722 1:200990462-200990484 CAAAAGGAGCAGAGGGAAGTGGG + Intronic
919991041 1:202709020-202709042 CAGCAGTAGGGGAGGGAGAAGGG + Intronic
920228272 1:204453663-204453685 CTACAGGAACTGAGGGAAGAAGG + Intronic
920418695 1:205814985-205815007 CACCAGGAGCGGATAGAAGGAGG - Intergenic
920539736 1:206769323-206769345 CCGCAGGTGCGAAGGGCAGATGG + Intronic
920742369 1:208593470-208593492 GGGCAGGAGTGGAGGAAAGAGGG + Intergenic
921300459 1:213746680-213746702 TAGCAGGAGGAGAGAGAAGATGG + Intergenic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
921363435 1:214351617-214351639 CAGCAGCAGGCGAGGGAAGATGG + Exonic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922604542 1:226881336-226881358 CAGGAGGAGGGAAGGGCAGAAGG - Intronic
922723284 1:227909791-227909813 AGGCAGGAGGGGAGGGAGGAGGG + Intergenic
922723315 1:227909872-227909894 AGGCAGGAGGGGAGGGAGGAGGG + Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922975792 1:229782365-229782387 AAACAGGAGTGGCGGGAAGAGGG + Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923152130 1:231242622-231242644 GAGCAGGCACGAAGGGAAGAGGG + Intronic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924089443 1:240487277-240487299 CAGCAGGAGCCGGGAGAAGAAGG + Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1064359968 10:14655691-14655713 CAGGAGGAGAGGTGGGAAGCCGG + Intronic
1064405683 10:15060050-15060072 CAGAAGGAGAGAAGAGAAGAGGG - Intronic
1065198100 10:23286476-23286498 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1066177774 10:32927304-32927326 CAACAGGAGTGGAGAGAAGCAGG + Intronic
1066728918 10:38419130-38419152 AAGGAGGAACGGAGGGAAGGAGG - Intergenic
1067061957 10:43082195-43082217 CAGGAGGAGCTGTGGGAACAAGG - Intronic
1067145715 10:43692369-43692391 AAGCAGGAGGGGAGAGCAGATGG - Intergenic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1067840954 10:49679206-49679228 CAGAAGGGGCCGGGGGAAGAAGG + Intergenic
1067972696 10:50991188-50991210 CAGCAGAAGCGGATCGAAGCAGG + Intergenic
1068050892 10:51947598-51947620 CAGCAGGAGGGGAGCCAAGATGG - Intronic
1068080522 10:52313534-52313556 GATCAGGGGTGGAGGGAAGAGGG - Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068573815 10:58660774-58660796 CAGGAGGAGAGGAGAGAAAAGGG + Intronic
1069593363 10:69655364-69655386 CACCAGGAGGTGAGGGAGGAAGG + Intergenic
1069667388 10:70172009-70172031 CAGGATGAGCGGAGGGTAGAGGG - Intergenic
1069752591 10:70753827-70753849 CAGCCGGAGCTGTGGGAAGCTGG + Exonic
1069824079 10:71244661-71244683 CAAGAGGAGAGGAGGGAGGAGGG + Intronic
1070887922 10:79921142-79921164 CAGCAGGAGAAGAAGGAAAAGGG - Intergenic
1071110613 10:82150723-82150745 CAGCAGAAGCAGATGAAAGACGG - Intronic
1071522642 10:86340699-86340721 TAGAAGGGGAGGAGGGAAGAAGG + Intronic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1071767388 10:88683158-88683180 AAGCAGGAATGGAGGCAAGAAGG + Intergenic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072943752 10:99790932-99790954 AAGCATGAGGGGAGGGGAGATGG + Intronic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1073248252 10:102106663-102106685 CAGCTGGAGTGGAGGAAATACGG + Intergenic
1073541838 10:104321381-104321403 CAACAGGGGCTGAGGGAAGATGG + Intronic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1073888554 10:108070156-108070178 GGGCAGGAGAGGAGAGAAGAGGG - Intergenic
1074142865 10:110690548-110690570 TAGCAGGAGCTGGGGGAAGAGGG - Intronic
1075081073 10:119384258-119384280 CAGCAGGAGAGAGAGGAAGAGGG - Intronic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075634342 10:124020055-124020077 CAGCTGGCGGGGAGAGAAGATGG - Intronic
1075778596 10:125003213-125003235 CAGCAGGAAAGCAGGGAACAGGG + Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075871702 10:125775786-125775808 CAGCAGTGTCGGACGGAAGATGG + Exonic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076408110 10:130226784-130226806 CAGCAGGGGAGGAAGGAAGATGG + Intergenic
1077077297 11:707442-707464 CAGCAGGGCAGGAGGGTAGAGGG - Intronic
1077089775 11:773173-773195 CAGCAGGGGTGCAGGGAGGAAGG - Intronic
1077137175 11:1006270-1006292 CAGGAGGGGCCGAGGGAGGAGGG + Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077868627 11:6243096-6243118 GAGCAGGAACAGAGGGAAGGGGG - Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078535906 11:12173703-12173725 TAGCAGGGGCTGAGGGAAGAAGG - Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1079321060 11:19451731-19451753 TAGCAGGAAAGAAGGGAAGAGGG + Intronic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1079344479 11:19639944-19639966 CAGCATGGGTGAAGGGAAGATGG + Intronic
1081651547 11:44827352-44827374 CAGCAGGGGCTGAGGGAGAAAGG - Intronic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1084086580 11:66857743-66857765 CAGCAGGAGCGGCGGGGCCATGG - Exonic
1084150420 11:67285593-67285615 CAGCAGGAGCCGAGGCAAGCGGG - Exonic
1084165166 11:67372241-67372263 TACCAGGAGAGGAGGGGAGACGG - Intronic
1084360402 11:68665222-68665244 CGGGAGGAGATGAGGGAAGAGGG + Intergenic
1084421294 11:69061892-69061914 CAGAAGGAAGGCAGGGAAGATGG + Intronic
1084768017 11:71325002-71325024 CAGCAGGAGCGATGGGAGGGTGG + Intergenic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1084974737 11:72790532-72790554 GAGCAGGGGCTGGGGGAAGAGGG - Intronic
1085322575 11:75583803-75583825 AAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1085386348 11:76160384-76160406 CAGCAGGGGCTGGGGGATGAGGG + Intergenic
1085446146 11:76602567-76602589 CAGGAGGGGAGGAAGGAAGAGGG - Intergenic
1085567754 11:77530183-77530205 TATCAGGAGCTGAGGGGAGAGGG - Intronic
1086221494 11:84450434-84450456 CAGCAGGAGCAAAAGCAAGAAGG + Intronic
1086437625 11:86798102-86798124 CAGCTGGAAGGAAGGGAAGAAGG - Intronic
1087272397 11:96124756-96124778 GGGCATGAGAGGAGGGAAGAAGG + Intronic
1088018107 11:105084627-105084649 CAGCAGGAGAGGTGGGGAGAAGG - Intronic
1089111659 11:116062302-116062324 CACAAGAAGCGGAGGGAAGGAGG + Intergenic
1089260148 11:117218703-117218725 AAGCAGGAGCTGAGGGCTGAAGG - Intronic
1089342806 11:117770957-117770979 GAGCAGGAGAGGAGAGAAGATGG + Intronic
1089398842 11:118152925-118152947 GAGCAGGAGCGGGAGGAAGACGG + Intergenic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089529447 11:119116841-119116863 GAGCAGGAGGGGAGGCAGGAAGG - Exonic
1089590304 11:119536026-119536048 GAGCAGGAGAAGAGAGAAGAGGG + Intergenic
1089641149 11:119848027-119848049 CAGGAGAAGGGGAGGGCAGAGGG - Intergenic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090373664 11:126274313-126274335 AGGCAGGAGTGGAGGGAACAAGG + Intronic
1090832342 11:130428242-130428264 CAGCAGGAGCGGAGGCCACCGGG + Exonic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1091412016 12:248032-248054 AAGCAGGAGGAGAGGGAAGGGGG + Intronic
1091679437 12:2516268-2516290 CAGCTGGAGAGGAGGGAGTAAGG + Intronic
1091689604 12:2586807-2586829 CAGGAGGAGGGGAGTGAGGATGG - Intronic
1091692818 12:2608723-2608745 AGGAAGGAGCGGAGGGAAGCGGG + Intronic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1092140630 12:6180868-6180890 CAGCAGCAGGGGAGGGGATAGGG + Intergenic
1094101101 12:26763886-26763908 GAGGAGGAGGGTAGGGAAGATGG - Intronic
1094491093 12:30961176-30961198 CAGCAGAAGAGGCAGGAAGAGGG - Intronic
1095148392 12:38759865-38759887 CAGCAGAAGGGAAGAGAAGAGGG + Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1096103603 12:48983971-48983993 GAACAGGAGAGGAGGGAATAGGG - Intergenic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096510106 12:52123025-52123047 CAGAAGCAGCGGCAGGAAGATGG - Intergenic
1096539150 12:52294502-52294524 AGGGAGGAGGGGAGGGAAGATGG + Intronic
1096817079 12:54208544-54208566 CAGCAGGATGGCTGGGAAGAGGG + Intergenic
1098009071 12:66031245-66031267 CAGCATGAGGGGAGGAAATATGG - Intergenic
1098065264 12:66608012-66608034 CAGCAGGTGGGGAGGGAGGCAGG + Intronic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1098998291 12:77147218-77147240 CAGCAGTAGCTGAGCAAAGATGG - Intergenic
1099163943 12:79278505-79278527 CAGCAAGAGCAGAGCTAAGAGGG + Intronic
1099286442 12:80718139-80718161 GAGCAGCAGCAAAGGGAAGAGGG - Intronic
1099302578 12:80916399-80916421 GAGCTGGAGCAGAGGGAACAAGG - Intronic
1099860148 12:88216128-88216150 CAGCAAGAGCAGCGGTAAGAGGG + Intergenic
1100717830 12:97324552-97324574 CAGCAGGAGAGGAGAGAGAAAGG + Intergenic
1102081808 12:110104372-110104394 AAGCAGGAGCTGAGGGCTGATGG - Intergenic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1102900057 12:116629412-116629434 CAGAAGGAGAGGAGAGAAGGCGG + Intergenic
1103820141 12:123691307-123691329 TGCCAGGAGCTGAGGGAAGAGGG - Intronic
1103933676 12:124463887-124463909 CGGCAGGAAGGGAGGGGAGATGG - Intronic
1104655804 12:130572999-130573021 CAGCAGTGGCTGTGGGAAGAAGG - Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104906105 12:132214280-132214302 CAGCAGGAGCCCAGGGATGAAGG + Intronic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1104963110 12:132497561-132497583 AAGCAGGAGCTGAGGCCAGAGGG - Intronic
1105285273 13:18998347-18998369 GAGGAGAAGCGGAGGGAAGGAGG - Intergenic
1105422038 13:20261596-20261618 GAGCTGGAGGGGAGAGAAGATGG - Intergenic
1105943249 13:25169993-25170015 CAGCTCGAGCAGCGGGAAGAAGG - Exonic
1106068247 13:26380045-26380067 CAGCAGGAGCAGTGGGATGCAGG + Intronic
1107263039 13:38518559-38518581 CAGCAGCAGCTGGGGGAACAAGG - Intergenic
1107307434 13:39037902-39037924 CACCAGGAGCCGGGCGAAGAGGG + Exonic
1107662336 13:42651529-42651551 CAGAAGGAGGGGAAGGGAGAGGG - Intergenic
1110533764 13:76627472-76627494 CAGCAGGAGTGGCAAGAAGATGG + Intergenic
1110818133 13:79883439-79883461 CACCAGGAGGTGAGGAAAGAGGG + Intergenic
1111654206 13:91132004-91132026 AAGCAGGAGAGGAGGTCAGATGG + Intergenic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1111985373 13:95060905-95060927 CACCAGGGGCTGAGGGAAGGTGG - Intronic
1112717660 13:102205128-102205150 CAGCAGAAACTGAGAGAAGAAGG + Intronic
1113938225 13:114006141-114006163 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938260 13:114006251-114006273 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938321 13:114006437-114006459 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938381 13:114006623-114006645 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938429 13:114006771-114006793 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938464 13:114006881-114006903 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938499 13:114006991-114007013 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938534 13:114007103-114007125 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938630 13:114007380-114007402 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938653 13:114007452-114007474 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1114345815 14:21793678-21793700 CATCAGGTGTGGAGGGTAGATGG + Intergenic
1114559347 14:23579077-23579099 AAGCAGGGGAGGAGGGAAGAAGG + Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1115073275 14:29353757-29353779 AAGCCAGAGCGGAGCGAAGATGG - Intergenic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1116378877 14:44239748-44239770 CAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1117047277 14:51826209-51826231 CAGCAAGAGCGGATGGCTGAAGG + Intronic
1117957074 14:61131058-61131080 CAGCAGGTGCAGGGGGCAGAGGG - Intergenic
1118171781 14:63395727-63395749 GAGGAGGAGCAGAGGGAAAAGGG + Intronic
1118186422 14:63542718-63542740 CAGGAGGACCGGGAGGAAGAAGG + Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1120119493 14:80661226-80661248 GAGCAGAAGAGGAGGAAAGATGG - Intronic
1120143603 14:80955565-80955587 GAGCGGGAGGGGTGGGAAGAGGG - Exonic
1120388359 14:83874009-83874031 CAGAAGGAGCAGACGGGAGAAGG + Intergenic
1120522033 14:85534730-85534752 CGGCGGCAGCGGAGAGAAGACGG + Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121859064 14:97299432-97299454 GAGGAGGATCGGAGTGAAGAAGG - Intergenic
1122632567 14:103113772-103113794 CACCAGGCGAGGAAGGAAGAGGG - Intergenic
1122744080 14:103887783-103887805 CAGCCCGAGCTGAGGGGAGAGGG - Intergenic
1122775246 14:104114069-104114091 CCTCAGGAGCTGAGGGAAGCAGG - Exonic
1122947616 14:105020497-105020519 CCGGAGGAGCCCAGGGAAGACGG + Intronic
1123054405 14:105562257-105562279 CAGCAGGAGGGGATGGGAGACGG + Intergenic
1123078989 14:105682676-105682698 CAGCAGGAGGGGATGGGAGACGG + Intergenic
1123509275 15:20979829-20979851 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123566499 15:21553576-21553598 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123602760 15:21990862-21990884 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1124359423 15:29024863-29024885 CAGGAGGAGCGGATGGAAGCAGG + Intronic
1125397102 15:39261025-39261047 GAGAAGGAGAGGAGAGAAGAAGG + Intergenic
1125612226 15:40979342-40979364 CAGCAGGAGTGAGGTGAAGAGGG - Exonic
1125697528 15:41651739-41651761 GAGGAGGAGGGGAAGGAAGAGGG - Intronic
1125697574 15:41651868-41651890 AGACAGGAGCGGAGAGAAGAGGG - Intronic
1125726526 15:41871123-41871145 GAGCAGGAGCTGTGGGAAGATGG - Intronic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1126696697 15:51332285-51332307 CAGCAGGAGAGGAGAGAATCTGG - Intronic
1126859828 15:52872834-52872856 TAGCAGGATAGGGGGGAAGAAGG + Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128865955 15:71115417-71115439 CCGCAAGAGGGGAGGGAGGAAGG + Exonic
1128881722 15:71249886-71249908 CAGCAGGAGTGGAAGGAAAGGGG - Intronic
1129272568 15:74427183-74427205 CAGCATGATCTGAGCGAAGATGG - Intronic
1129743221 15:78000316-78000338 CAGGAGGAGCGGAGGTGAGTGGG - Intronic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1130162213 15:81413439-81413461 CAGCATAAGCTGAGGGGAGATGG - Intergenic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1131392993 15:92064193-92064215 CAGCAGGCGAGAAGGGGAGAAGG - Intronic
1131393050 15:92064856-92064878 CAGCTGGAGGGTAGGGAGGAAGG + Intronic
1131468147 15:92672412-92672434 GAGCGGGAGGGGAGGGCAGATGG - Intronic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1132389422 15:101427620-101427642 CAGCAGGACCAGAGGAGAGAGGG + Intronic
1202974863 15_KI270727v1_random:280664-280686 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1132609859 16:810255-810277 CAGAAGGAAGGGAGGGGAGAGGG + Intronic
1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG + Exonic
1132712746 16:1276718-1276740 CAGCAGCAGCTGCGGGGAGAGGG + Intergenic
1133839504 16:9394771-9394793 AAGCAGGAAGGGAGGGAGGAAGG - Intergenic
1134449511 16:14354475-14354497 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449521 16:14354497-14354519 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449536 16:14354536-14354558 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1135887271 16:26321686-26321708 CAGCCAGAAGGGAGGGAAGAAGG - Intergenic
1135887707 16:26326504-26326526 AAGGAGGAAAGGAGGGAAGAAGG + Intergenic
1136366565 16:29811854-29811876 GAGCAGGAGGGCAAGGAAGATGG - Intronic
1136511689 16:30741801-30741823 CAGCAGCAGCGGATGGGGGATGG - Intronic
1136553554 16:30994803-30994825 GAGCAGGAGATGAGGGGAGAGGG - Intronic
1137406888 16:48196279-48196301 CAGGAGGAGGAGATGGAAGAAGG - Exonic
1137975878 16:53031581-53031603 CTGCAGGAGAGGAGAGAGGAAGG + Intergenic
1138961494 16:62035206-62035228 TCGCAGGATCGGAGGGAAAAAGG - Intronic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139210033 16:65068025-65068047 AAGCAGGGAGGGAGGGAAGAAGG + Intronic
1139548596 16:67661235-67661257 CAGCAGTGGAGGAAGGAAGACGG - Intronic
1139588449 16:67919422-67919444 CAGCAGGCTGGCAGGGAAGAAGG - Intronic
1140122660 16:72096904-72096926 GAGCGGGAGCGGCGGGAACATGG + Exonic
1140603504 16:76506442-76506464 AAGCGGAAGGGGAGGGAAGAAGG - Intronic
1140943608 16:79747090-79747112 GAGAAGGAGACGAGGGAAGAGGG + Intergenic
1141627950 16:85271310-85271332 AGGCAGGAGCGCGGGGAAGAGGG - Intergenic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1142135023 16:88447960-88447982 AAGAAGGAAGGGAGGGAAGAGGG + Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142422431 16:89980282-89980304 AGGCAGGAGAGGAGGGAAGCAGG + Intergenic
1142500917 17:332483-332505 CATCAGGAAGGGAGGGAAGGAGG - Intronic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1142781328 17:2183238-2183260 AGGCAGGAAGGGAGGGAAGAAGG + Intronic
1143126229 17:4642414-4642436 CAGCAGGGGCGGCGGGGGGAGGG - Intergenic
1143390591 17:6556972-6556994 CAGAGGGAGCGGAGAGAGGAAGG + Intergenic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1143965687 17:10755266-10755288 GAGCTGTAGCTGAGGGAAGAGGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144118422 17:12125017-12125039 AAGCTGAAGCTGAGGGAAGAGGG - Intronic
1144959815 17:19038756-19038778 CAGCAGGAGGGGAGCGTAGGGGG + Intronic
1144975345 17:19135768-19135790 CAGCAGGAGGGGAGCGTAGGGGG - Intronic
1145061232 17:19735558-19735580 AAGCAAGAGTGGAGGAAAGAAGG + Intergenic
1145415327 17:22709926-22709948 CAGGATGAGGGGATGGAAGATGG + Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146332219 17:31937080-31937102 GAGGAGGAGAGGAGGGAAGGAGG - Exonic
1146569896 17:33943239-33943261 GAGGAGAAGCGCAGGGAAGAAGG + Intronic
1147369220 17:39980377-39980399 CGGCAGGAGGGAAGGAAAGAAGG - Intergenic
1147375381 17:40019755-40019777 CAGCAGGAGAGCCGGGAAGGTGG + Intronic
1147416619 17:40295904-40295926 CAGCAGGAGGGGCAGGAGGATGG - Intronic
1147565734 17:41535491-41535513 TGGCAGGAGGGGAGGGAAGGGGG + Intergenic
1147726285 17:42567781-42567803 CAGCAGGAGCTGAAGGACAAGGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148102190 17:45099047-45099069 CAGAAGGGGAGGAGGGAGGAGGG + Intronic
1148338703 17:46860234-46860256 AAGGAGGAGAGGAGGGAAGCGGG + Intronic
1148673838 17:49433359-49433381 GAGAAGGAAGGGAGGGAAGATGG + Intronic
1148721220 17:49754648-49754670 GAGAAGAAGGGGAGGGAAGAGGG + Intronic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1149305925 17:55346516-55346538 GGACAGGAGGGGAGGGAAGAGGG - Intergenic
1149450787 17:56748409-56748431 CAGCAGGAGGGAAGGCAGGAAGG - Intergenic
1150712840 17:67546451-67546473 CTACAGGAGCACAGGGAAGAGGG - Intronic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1150959198 17:69895659-69895681 CAGCAGGAGCTGAGAGATGGAGG + Intergenic
1151111403 17:71682343-71682365 CAGCAGTAGGATAGGGAAGAAGG - Intergenic
1151174201 17:72273795-72273817 AGCCAGGAGCAGAGGGAAGAGGG + Intergenic
1151175223 17:72282520-72282542 CAGCAGGTGGGAAGGGGAGAGGG - Intergenic
1151677426 17:75605850-75605872 CAGCAGGACCTGTGGGTAGAGGG - Intergenic
1151734772 17:75932416-75932438 AACCAGGAGCTGAGGGAAGTGGG + Intronic
1151951872 17:77359042-77359064 CAGCCAGAGGGAAGGGAAGAAGG + Intronic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152589724 17:81205484-81205506 CAGCGGGAGGGGAGGTAGGAGGG + Intronic
1152671844 17:81612937-81612959 CAGCTGCAGGGGAGGGAGGAGGG - Intronic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154197814 18:12279227-12279249 CAGCAGGAGAGGAGGTGAGGAGG + Intergenic
1154293019 18:13127157-13127179 CAGCTGGAGCTCAGGGAGGACGG - Intergenic
1155433367 18:25785609-25785631 CAGCAGAGGCAGAGGGGAGAGGG - Intergenic
1155877188 18:31101912-31101934 CAGCAGGAGCAGCCGGCAGAGGG + Exonic
1156178278 18:34573341-34573363 TGGCAGGAGAGGAGGGAAGCAGG - Intronic
1156457350 18:37302246-37302268 CAGCAGGAGAGGATAGGAGAAGG - Intronic
1156658265 18:39313457-39313479 CAGCAAGAGGAGAGGGGAGAAGG - Intergenic
1157528992 18:48406302-48406324 CAGCAGGGGCGGTGTGAAGGGGG - Intronic
1157602873 18:48905047-48905069 CAGCAAGAGACAAGGGAAGAAGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158516896 18:58138322-58138344 GAGGAGGAGGGGAGGGAAGAAGG - Intronic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1159337448 18:67088349-67088371 AAGAAGGAGGGAAGGGAAGAAGG + Intergenic
1159553099 18:69917394-69917416 CAGAAGGAGGGAAGGAAAGATGG - Intronic
1159578163 18:70205382-70205404 GGGCAGGAGCGGCGTGAAGACGG + Intronic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160107704 18:75993991-75994013 CAGAAAGAGAGGAGGGAAAAGGG - Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1161290295 19:3490516-3490538 CAACAGGAGCTGGGGGAAGACGG + Intergenic
1161597085 19:5156100-5156122 CCGCAGGAGCGGGTGGAAAAAGG + Intergenic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161694624 19:5759197-5759219 TAGCAGGAGCGAAGAGAAGCAGG + Intronic
1161746102 19:6061128-6061150 CAGCAGGAGCGGAAGGAAGGGGG - Intronic
1162021201 19:7869395-7869417 CGGCACGAGCGGTGGGAAGGCGG - Exonic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162119744 19:8456324-8456346 TAGCAGCACAGGAGGGAAGAAGG - Intronic
1162341954 19:10096583-10096605 GAGGAGGAACGGAAGGAAGACGG + Intronic
1162992841 19:14314583-14314605 GAGCAGGAGGGGAGTGCAGAAGG + Intergenic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163203747 19:15787406-15787428 CAGGAGGAAGGGAGGAAAGATGG + Intergenic
1163475602 19:17524226-17524248 CAGCAGGAGGGGATAGAGGATGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163752458 19:19085828-19085850 CAAGAGGAGAGGAGGGGAGAGGG + Intronic
1164412925 19:28020715-28020737 AAGCAGGAGCGGGAGGAGGAGGG + Intergenic
1164834598 19:31349415-31349437 CCGAACGTGCGGAGGGAAGAAGG + Exonic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166159431 19:40940936-40940958 GATGAGGAGAGGAGGGAAGAGGG + Intergenic
1167286655 19:48602221-48602243 AAGAAGGAGAGGAGGGAGGAGGG + Intronic
1167430121 19:49449373-49449395 CTCCAGGAGCTGAGGGAGGAGGG + Intronic
1167466019 19:49651519-49651541 CAGCAGGGGCGGCGGGAGGGCGG - Exonic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168400792 19:56085220-56085242 CAGCAGCAGCCGAGGAATGATGG + Intergenic
1168464973 19:56594951-56594973 AAGTAGGAGAGGTGGGAAGAAGG - Intergenic
1168519399 19:57036519-57036541 CGTGAGGAGAGGAGGGAAGACGG + Intergenic
1168539956 19:57201961-57201983 CAGCAGTATGGGAGGCAAGAGGG + Intronic
925107632 2:1306536-1306558 CAGCAGGAGCGGGGGGACAGTGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925262642 2:2541748-2541770 CAGGAGGAGAGGGGGAAAGAGGG + Intergenic
925280395 2:2680334-2680356 CAGCAGGAGTGGGGGAAGGAGGG + Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926593764 2:14767669-14767691 CAGCAGGTGCGGACGTAAGAAGG - Intergenic
926819910 2:16840647-16840669 CAGCAGTACCTGGGGGAAGAAGG - Intergenic
926914039 2:17876751-17876773 CTGCAGGAGCTGAGGACAGAAGG - Intergenic
927151590 2:20199372-20199394 CAGCACGATCTGAGAGAAGATGG + Intergenic
927181631 2:20450621-20450643 CTCCAGGAGCAGAGGGGAGAGGG + Intergenic
927505168 2:23608150-23608172 CAGCATGATGGGAGGGAAAAAGG + Intronic
927517320 2:23679983-23680005 GAGGAGGAGCGGAGGGAACGGGG + Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928121391 2:28586305-28586327 CTATAGGAGCGGAGGGCAGAGGG - Intronic
928285671 2:29988080-29988102 CAGCAGTAGGGGAGTGAGGAAGG - Intergenic
928697056 2:33859982-33860004 CCGCAGGAGGGGAAGGAAGGAGG - Intergenic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929942935 2:46348544-46348566 CAGCAGGAAAGCAGGGGAGAGGG - Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
931064689 2:58572104-58572126 CAGGAGGGGCAAAGGGAAGATGG - Intergenic
931701521 2:64913081-64913103 CAGCAGTAGTGGCAGGAAGAAGG + Intergenic
932583598 2:73008479-73008501 CCGCAGCAGCCAAGGGAAGAGGG + Intronic
933127894 2:78634169-78634191 CGGGAGGAAGGGAGGGAAGAAGG + Intergenic
933217177 2:79643961-79643983 CAGCAGAAGAGGATGTAAGACGG - Intronic
933725326 2:85423745-85423767 CAGCAGGCGAGGGAGGAAGAGGG + Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934760995 2:96857151-96857173 TAGGAGGGGCGGAGGGAAGTAGG + Intronic
934893727 2:98093129-98093151 CAGCAGCTGCAGAGGCAAGAGGG + Exonic
935811356 2:106800643-106800665 CAGCAGGAGCTAGGGGAAGGAGG - Intergenic
935814588 2:106835331-106835353 TAGCAGGAACTCAGGGAAGAAGG - Intronic
936627185 2:114161017-114161039 GAGAAGGAGGGGAGAGAAGAGGG - Intergenic
936917558 2:117655451-117655473 TGGCTGGAGCTGAGGGAAGAAGG + Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
938157595 2:128954949-128954971 CAGCGGGAGCGGAGGACAGAGGG - Intergenic
939016529 2:136910230-136910252 AAGCAGGAGTGGAGCCAAGAGGG + Intronic
939212734 2:139197790-139197812 AAGAAGGAGTGTAGGGAAGAGGG + Intergenic
940518570 2:154713475-154713497 CAGCAGGAGTGGTGGGGGGAGGG + Intronic
940906545 2:159174897-159174919 CAGAAGGAGCTGTGTGAAGAGGG + Intronic
941015096 2:160346561-160346583 CAGGAGGAGTGGACGGATGATGG - Intronic
941646931 2:168050611-168050633 CAGAAGGAGCCGAGGGATGCAGG + Intronic
941949877 2:171143763-171143785 CAGCAGTAGAGGAGGGAAAGAGG + Intronic
941985946 2:171511867-171511889 CAGCAGGAGAGGGGGACAGAGGG + Intergenic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
946644491 2:221818316-221818338 AAGCAGGACCCTAGGGAAGAGGG - Intergenic
947472277 2:230411035-230411057 CACCAGGAGCGGAGGGAGCCTGG - Intergenic
947522822 2:230861735-230861757 CAGGAGGAGCAGTGGGCAGAAGG + Intergenic
947702484 2:232246130-232246152 CAGCAGAAGAGCAGGGAGGATGG + Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
948734648 2:239993891-239993913 CGGCAGGAGGGAAGGCAAGATGG + Intronic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
948803205 2:240442070-240442092 CAGCAGGAGCTGGCGGGAGATGG - Intronic
949039995 2:241843824-241843846 CAGCAGGAGCGAAGGTGAGCGGG - Intergenic
1168810115 20:699669-699691 AAGCAGGAGAGGTGGGAAAAAGG - Intergenic
1169289130 20:4333529-4333551 CAGCAGGAGAGGAGGGACCCAGG - Intergenic
1169318014 20:4609205-4609227 GAGCAGGGGCAGAAGGAAGAGGG + Intergenic
1169359904 20:4939194-4939216 CACCAGGGGTGGAGGTAAGATGG - Intronic
1169367056 20:5000916-5000938 CATCAGGAGGGGCGGCAAGAGGG - Intronic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1169993064 20:11525069-11525091 CAGCTGGAGCAGAGGGAATAAGG + Intergenic
1170357363 20:15507307-15507329 AAGCAGGAAGGGAGGGAGGAAGG - Intronic
1170369451 20:15632822-15632844 AAGAAGGAGAGGAGGGAAGGAGG - Intronic
1170578672 20:17682178-17682200 CGGCCGGAGCGGACGGCAGACGG - Exonic
1170579377 20:17686381-17686403 CAGCAGGAGTGAAGGAGAGAGGG + Intergenic
1171365165 20:24618053-24618075 CAGGAAGAGCCGGGGGAAGAGGG + Intronic
1171781046 20:29417987-29418009 CAGCAGTGGGGGAGAGAAGAAGG - Intergenic
1172273570 20:33667874-33667896 CAGCAGGCCCGGCTGGAAGATGG - Exonic
1173175652 20:40762940-40762962 CAGCAAGAGGGGAGGGAAATGGG + Intergenic
1174336073 20:49861654-49861676 GGGCAGTAGGGGAGGGAAGAAGG + Intronic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175226134 20:57444996-57445018 CAGCAGGAGGTGTGGGAAGCAGG + Intergenic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1175826948 20:61941695-61941717 CAGGAGGCACGGAGGGCAGAGGG - Intergenic
1177012863 21:15750088-15750110 CAGCATCCGGGGAGGGAAGAGGG + Intronic
1177736209 21:25092930-25092952 GAGCAGGAGCCGGGGGAAGAGGG - Intergenic
1178163695 21:29947900-29947922 GAGCAGGAGCTGGAGGAAGAGGG - Intergenic
1178270059 21:31181481-31181503 CAGAAGGAGCGGGGAGAGGAAGG + Intronic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1179799530 21:43804484-43804506 CAGCAGGTGTGAAGGGGAGAGGG - Exonic
1179977337 21:44875856-44875878 GAGAAGGAGCTGAGGGAGGAGGG - Intergenic
1179978809 21:44885801-44885823 CAGCAGGTGAGGAAGGAAAAGGG + Intergenic
1179991494 21:44950486-44950508 CTGCAGGAGCGCAGGTAAGAAGG - Intronic
1180035875 21:45248940-45248962 CAGCAGGAGAGGGGGCAGGAGGG + Intergenic
1180150394 21:45944222-45944244 GAGCAGGTGAGGAGGGGAGACGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1180938557 22:19641897-19641919 GAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1181359927 22:22326784-22326806 CAGCAGGAGAGGTGAGGAGAGGG - Intergenic
1181369951 22:22408213-22408235 CAGCAGGAGAGGTGAGGAGAGGG - Intergenic
1181484712 22:23223535-23223557 TACCAGGAGAAGAGGGAAGAAGG - Intronic
1181615177 22:24049436-24049458 CAGCAGGAGAGGCGGGCAGCAGG - Intronic
1181615248 22:24049827-24049849 CAGGTGGAGAGGTGGGAAGATGG - Intronic
1181885306 22:26017367-26017389 AAGGAGGAGGGGAGGGAGGAAGG - Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182355884 22:29722065-29722087 CAGGAGGAGGGGATGGATGAGGG - Intronic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1182516391 22:30861443-30861465 CAGCAGGAGATGAGGAGAGAGGG + Intronic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1183115633 22:35690547-35690569 GAGGAGAAGGGGAGGGAAGAGGG + Intergenic
1183151050 22:36037661-36037683 CAGCAGGGGCTGAGGAGAGAGGG - Intergenic
1183279766 22:36925733-36925755 AAGCAGGTGAGGAGGGAGGAAGG - Intronic
1183295844 22:37029190-37029212 CAGCAGGGGAGCAGGGAGGAGGG - Intronic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183354538 22:37351143-37351165 AAGGAGGAGAGGAGGGAGGAGGG - Intergenic
1183368296 22:37418628-37418650 CAACAGGAGAGGAGGGTAGTTGG - Intronic
1183585852 22:38752550-38752572 CAGCAGCAGCGGAGGGAGCTCGG - Exonic
1183704463 22:39468449-39468471 CAGGAGGAGCTATGGGAAGACGG - Intronic
1183746258 22:39693810-39693832 CAGAAAGAGAGGAGGGGAGATGG - Intergenic
1183785162 22:40025000-40025022 CAGCAGGAGGCGAGGGCGGAGGG - Intronic
1183961667 22:41414956-41414978 AAGCAGGAGGGAAGGGAAGGAGG - Intergenic
1184027711 22:41870267-41870289 CAGCAGGAGCAGAGCAGAGATGG - Intronic
1184456104 22:44610131-44610153 CAGCTGGTGCGGAGGCAGGAGGG + Intergenic
1184537114 22:45094703-45094725 CATGAGGAGGGGGGGGAAGAGGG - Intergenic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184981809 22:48100592-48100614 CAGCAGGAGCCCAGGGAACATGG - Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185345239 22:50307871-50307893 GAGCAGGAGCGGGGAGGAGAGGG + Intergenic
950440890 3:13009585-13009607 CAGGAGGAGGTGAGGGATGAGGG - Intronic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
952262549 3:31754389-31754411 CAAGATGAGCGGAAGGAAGAGGG + Intronic
953108265 3:39907152-39907174 CAGATGGAGAGGAGGGAACATGG - Intronic
953273912 3:41476028-41476050 GGGCAGGAGAGGAGGGAAAAAGG + Intronic
953347048 3:42184976-42184998 CAGCAGGAGCTGCAGGAAGGTGG - Intronic
954143784 3:48623974-48623996 CAGCATGAGCTGAGGTGAGAGGG - Intergenic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954672556 3:52298700-52298722 CAGCAGGAGTGGGAGGCAGAGGG - Intergenic
954692843 3:52404920-52404942 CAGCAGGAGCTTAGGGAGGCAGG - Intronic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955800465 3:62680996-62681018 CAGCAGGATCACAGGGAACATGG - Intronic
956612446 3:71137869-71137891 CAGGAGGAGGGAAGGGGAGAAGG - Intronic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
956857156 3:73286544-73286566 CAGTAGGAGAGAAGGAAAGAGGG + Intergenic
957083948 3:75663298-75663320 CAGCAGAGGGGGAGAGAAGAAGG + Intergenic
958542435 3:95496165-95496187 CAGCAGGAGAGGAGGGTGGGTGG - Intergenic
960586169 3:119323039-119323061 GAGCTGGAGCGGAGGGAACGTGG - Intronic
961009713 3:123427461-123427483 CAGCAGGAGCGAAGGCATGGTGG - Intronic
961046669 3:123713195-123713217 CAGCAAGAAAGAAGGGAAGATGG + Intronic
961171732 3:124802061-124802083 CTGCAGGAGCCCAAGGAAGAAGG - Intronic
961413136 3:126737713-126737735 CAGGTGGAGAGGAGGGAGGAAGG + Intronic
961532275 3:127547100-127547122 CAAGAGGAGAGGAGGGGAGAGGG + Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961605438 3:128091284-128091306 CAGCAGGAGCTGGGGGAACGGGG + Intronic
962039708 3:131693745-131693767 CAGGAAGAGGGGAGGTAAGAGGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962468746 3:135686495-135686517 CAGCAGGAGCTGTGAGGAGAGGG + Intergenic
962518995 3:136180735-136180757 GAGGAGGAGAGGAGGGAAGGAGG + Intronic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
963230464 3:142904413-142904435 GAGCAGGAGAGGAGAGAAGGAGG + Intergenic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
964636242 3:158860625-158860647 CAGCAGCCAGGGAGGGAAGAGGG - Intergenic
965080398 3:164024823-164024845 GAGCAGGAGCGTGGGGCAGAGGG + Intergenic
965158031 3:165089524-165089546 GAGCAGGAGCAGAGAGAAGAAGG + Intergenic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
967278005 3:187795401-187795423 AAGAAGGAAGGGAGGGAAGATGG + Intergenic
967925169 3:194640152-194640174 CTGCAGGAGGGGAGGCGAGACGG + Intergenic
968039649 3:195578566-195578588 TAGCGGGAGGGGAAGGAAGAGGG - Intronic
968905908 4:3450380-3450402 CAGCAGGGGCCGTGGGGAGAAGG - Intergenic
969075188 4:4572620-4572642 TAGCAGGAGGGGTGGAAAGAGGG - Intergenic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969400835 4:6954308-6954330 GAACAGGAGCGCAGGGGAGATGG - Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
970321467 4:14879627-14879649 AAGCAGGATCTTAGGGAAGATGG - Intergenic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971362164 4:25948147-25948169 CACCAGGGGCTGAGGGGAGAGGG - Intergenic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
974220460 4:58962688-58962710 AAGGAGGAGGGGAGGAAAGAGGG - Intergenic
975397907 4:73898901-73898923 CAGCAGGAAGGAAAGGAAGATGG + Intergenic
976593192 4:86869816-86869838 CAGCAAGAATGGAGGGAAAAAGG - Intergenic
976607148 4:86994757-86994779 CAGCTGGAGCAGAGGGAAAGGGG + Intronic
977997989 4:103517676-103517698 AGGCAGGAGAGGAGGGAAGGAGG - Intergenic
978924919 4:114231600-114231622 CAGCAGCTGTGGAGGGATGAAGG - Intergenic
981533198 4:145773023-145773045 GAGCAGGATGGGAGGGAGGAAGG + Intronic
982088138 4:151857190-151857212 TAGCATGAGGGGAGGGAGGAGGG - Intergenic
982220318 4:153119124-153119146 CAGCTGGACAGGAGGGGAGAGGG - Intergenic
983382072 4:167008838-167008860 CAGCAAGAAGGGAGGGAAGCAGG + Intronic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984703167 4:182831874-182831896 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703333 4:182832359-182832381 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703344 4:182832391-182832413 CAGAAGGAGGGGAGAGGAGAAGG - Intergenic
984703739 4:182833877-182833899 AAGGAGGAGGGGAGGGGAGAAGG - Intergenic
984873286 4:184345976-184345998 CAGGAGGAGCGGCAGCAAGAGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985388272 4:189467526-189467548 AAGCAGGTGCAGAGGGAAAATGG + Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
985629911 5:1008927-1008949 CGGTAGGAGGTGAGGGAAGATGG - Exonic
985675609 5:1229931-1229953 AGGCTGGAGGGGAGGGAAGAAGG + Intronic
985675619 5:1229967-1229989 AGGCTGGAGGGGAGGGAAGAAGG + Intronic
985675658 5:1230114-1230136 AGGCTGGAGGGGAGGGAAGAGGG + Intronic
985767581 5:1787922-1787944 GAGCAGGAGGGGAGGGAGGAGGG - Intergenic
985800684 5:2003862-2003884 CAGCTGAGGCGGAGGAAAGAGGG + Intergenic
986150905 5:5129743-5129765 CAGCAAGGGCAGAGGGCAGATGG - Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
986424561 5:7617746-7617768 CACCAGGAGAGGAAGGAAGGTGG + Intronic
986583925 5:9294857-9294879 GAGAAGGAGGGGAGGGATGAAGG - Intronic
987026930 5:13936850-13936872 CAGCAGAAGTGGATGGAGGATGG + Intronic
989563756 5:42880372-42880394 TAGGAGGAGGGGAAGGAAGATGG - Intronic
990446126 5:55896386-55896408 CAGCTGAGGCGGATGGAAGAAGG + Exonic
990766198 5:59186056-59186078 GAGAAAGAGAGGAGGGAAGAAGG - Intronic
992380118 5:76228478-76228500 CAGCAGGAGGGTGGGGAGGATGG + Intronic
992663666 5:78985165-78985187 CAGCAGCAGCGGGAGGACGACGG + Exonic
993491470 5:88556629-88556651 AAGGTGGGGCGGAGGGAAGAAGG - Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994985538 5:106928433-106928455 CAGAAAGAGCTGGGGGAAGATGG + Intergenic
995004593 5:107176222-107176244 CAGCAGGAGAGGAGAGGAAAAGG + Intergenic
995845476 5:116489251-116489273 CAGCAGCAGCTCAGGGAACAGGG + Intronic
995975322 5:118028766-118028788 GAGAAGGAGCGGAGGGGAGAAGG - Intergenic
996217469 5:120887122-120887144 CAGCACCAGCAGAGGGTAGAAGG + Intergenic
996403932 5:123089031-123089053 CAGAAGAAGGGGAGGGGAGAGGG - Intergenic
996506315 5:124271198-124271220 CAGGAGGAGGGAAGGGAAAATGG + Intergenic
998269598 5:140694693-140694715 CAGCAGGAGCTGAGTAGAGATGG - Intronic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
998406844 5:141878815-141878837 GAGCAGGTGCCCAGGGAAGAAGG - Intronic
999147500 5:149405984-149406006 CAGCATGAGCTCTGGGAAGAAGG + Intergenic
999244922 5:150148994-150149016 CAGCAGGAGGCCAGGGAAGGAGG + Intronic
999366125 5:151024613-151024635 CAGCAGCTGGGGAGGGAGGAAGG + Intronic
999406913 5:151314677-151314699 CAGCAGGACAGAATGGAAGAAGG + Intergenic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001710903 5:173777231-173777253 AAGCAGGAGTGGAGGACAGAGGG + Intergenic
1001855332 5:175005507-175005529 CAGCAGGAGCGGAGTCAGGCAGG + Intergenic
1002169117 5:177365711-177365733 CAGCAGGGGCTGGGGGAGGAGGG + Intronic
1002355651 5:178626993-178627015 CAGCGGCCGAGGAGGGAAGACGG - Exonic
1002454574 5:179338847-179338869 CACCAGGCGTGGAGGGAAGCCGG + Intronic
1002461431 5:179375845-179375867 CAGCAGGGGAGGGGGGAAGGGGG + Intergenic
1002886993 6:1306273-1306295 CACAAGGAGGGGAGGGAAGAAGG - Intergenic
1002931658 6:1639151-1639173 GAGCAGGAGCGGAGGAGAGAGGG + Intronic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003706352 6:8535589-8535611 CAACAGGAAATGAGGGAAGAAGG - Intergenic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1005105847 6:22223465-22223487 CAGGAGGAGAGGTGGGAAGAAGG - Intergenic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006433017 6:34009757-34009779 CAGCAGGAGGGGAGAGGAAAGGG + Intergenic
1006517313 6:34552191-34552213 CTGGAGGAGGGTAGGGAAGAGGG - Intronic
1006535490 6:34696213-34696235 CAGGAGGGGCGGAAGGGAGATGG - Intronic
1006672829 6:35740279-35740301 CAGCAGGAAAGCAGGGAGGATGG - Intronic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1006702556 6:35987706-35987728 CAGCAGGGGAGGAAAGAAGAGGG + Intronic
1006750213 6:36372311-36372333 CAGCAGGAGCACGGGGGAGAAGG + Intronic
1006920751 6:37625666-37625688 CAGAAAGAAGGGAGGGAAGAGGG - Intergenic
1007313054 6:40961950-40961972 CATCCAGAGCGGAGGGAAGCTGG - Intergenic
1007761268 6:44135003-44135025 CAGCAGTGCCTGAGGGAAGAGGG - Exonic
1008664845 6:53706003-53706025 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009027359 6:58016039-58016061 CTTCAGGAGAGAAGGGAAGAAGG - Intergenic
1009405731 6:63310141-63310163 CAACAGGAGCCTAGGAAAGAAGG - Intronic
1009480104 6:64146521-64146543 CAGCAGGGGAAAAGGGAAGAAGG + Intronic
1009963415 6:70552400-70552422 CAGCAGGAGCGGCGGGGCGAGGG + Intronic
1010703125 6:79077089-79077111 CGGCGGGAGCGGCGCGAAGAGGG - Intronic
1011097116 6:83678684-83678706 GAGCAGGAGTGGAAGGTAGAAGG - Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012005167 6:93704898-93704920 AAGCAGGAGGGAAGGAAAGAGGG - Intergenic
1012487270 6:99736387-99736409 CAGCAGGAGCTGGGGTAAGATGG - Intergenic
1013760370 6:113510960-113510982 CAGCAGGGGGTGAGGAAAGAGGG + Intergenic
1014644390 6:123954991-123955013 CAGAAGGGGAGGAGGGGAGAAGG + Intronic
1015018487 6:128443310-128443332 AAGAAGGAGATGAGGGAAGAGGG + Intronic
1016402335 6:143694096-143694118 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1016888309 6:148980318-148980340 CAGCAGCCGTGGAGAGAAGATGG - Intronic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017230083 6:152064273-152064295 CAGCAGCTGCGGAGGAAGGATGG + Intronic
1017730170 6:157308632-157308654 CAGCAGAAGAGGAGGCAAGACGG + Intronic
1017769832 6:157636496-157636518 CAGCAGGAGGGAAGTGAGGATGG - Intronic
1017791328 6:157802181-157802203 TAGCAGCTGCGGAGGGCAGAGGG - Intronic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1018304844 6:162444138-162444160 CAGCAGGTGCAGTGAGAAGACGG - Intronic
1018379345 6:163243567-163243589 CAGCAGGAGCCGCGGGATGGTGG + Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019494907 7:1333325-1333347 GAGGAGGTGAGGAGGGAAGAGGG - Intergenic
1019513866 7:1431289-1431311 CAGCCGGAGCGGAGGGGGCAAGG + Intronic
1019751899 7:2735884-2735906 GGGCTGGAGGGGAGGGAAGAAGG + Intronic
1019891994 7:3954482-3954504 AAGCAGGAGGGGAGGGGGGAGGG - Intronic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1022092646 7:27117657-27117679 CAGCCGGAGCAGCTGGAAGAGGG - Intronic
1022423566 7:30246469-30246491 CAGCAGCACCGGAGGAAAGCAGG + Intergenic
1023055169 7:36285047-36285069 GAGCAGGAGAGGGGGGAAGGAGG + Intronic
1023330019 7:39105088-39105110 CATCAAGAGCAGAGGGCAGATGG + Intronic
1023522087 7:41059151-41059173 CAGCAGGAGAGTAGGGGAGGGGG - Intergenic
1023743004 7:43297585-43297607 CAGGAGCAGCGGAGGCATGATGG - Intronic
1023752445 7:43385294-43385316 ACGCAGGAGGGGAGGGGAGAGGG - Intronic
1024346766 7:48321757-48321779 AAGCAGGAGCCGAGGTGAGAAGG + Intronic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1026127011 7:67587898-67587920 CAGCAGGAAGGAAGGAAAGAGGG - Intergenic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1026601727 7:71783104-71783126 AATCAGGTGTGGAGGGAAGATGG + Exonic
1026662827 7:72317182-72317204 AGGCAGGAGGGGAGGGAAGGAGG + Intronic
1026972943 7:74479056-74479078 CAGCAGCAGGGGATGGAGGACGG - Intronic
1027194470 7:76020205-76020227 CAGGATGAGCTTAGGGAAGAAGG + Intronic
1027681924 7:81232737-81232759 CAGCACCAGCGGAGGGCAGGAGG + Intergenic
1028637041 7:93000853-93000875 GAGCAGGTGCAGAGGAAAGAGGG - Intergenic
1029443786 7:100602093-100602115 AAGCAGGGGCGGGGGGAGGATGG + Intergenic
1029444377 7:100604383-100604405 CGGGAGGAGGGGAGAGAAGACGG - Intronic
1029531363 7:101127399-101127421 CTGCAGGAGAGCAGGGAGGATGG + Intronic
1029875020 7:103741550-103741572 AAGGAGGATGGGAGGGAAGAAGG + Intronic
1029926922 7:104328489-104328511 CAGCGGCGGCGGCGGGAAGAGGG + Intergenic
1030124353 7:106140403-106140425 AAGCAGGAGAGGAGAAAAGATGG + Intergenic
1031448103 7:121879824-121879846 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1031856125 7:126924622-126924644 CAGAAGGAAGGGAGGAAAGAAGG - Intronic
1031931486 7:127690388-127690410 CTGCATGAGCTGAGGGCAGAAGG - Intronic
1031991153 7:128200152-128200174 AAGGAGGAGGGGAGGAAAGACGG - Intergenic
1032067165 7:128780232-128780254 CAGCTGGAGGGGAGGGGAGTGGG - Intergenic
1033933007 7:146547494-146547516 TTCCAGGAGCTGAGGGAAGAGGG - Intronic
1034409371 7:150931685-150931707 TGCCAGGAGCTGAGGGAAGAGGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034895328 7:154872669-154872691 CACCAGGAGCAGAGGGTAGTGGG - Exonic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035268011 7:157702849-157702871 CAGAAGGAGCTGAGGTCAGAAGG + Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035427225 7:158787122-158787144 CTGCAGGAGCCCAGGGAAGGAGG + Intronic
1036154166 8:6326242-6326264 CAGGAGGAAGGAAGGGAAGAAGG + Intergenic
1036370202 8:8155946-8155968 TAGCAGGAGTGGAGCCAAGATGG + Intergenic
1036478660 8:9118180-9118202 CAGCAGGAGAAGTGGAAAGAGGG - Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036760261 8:11503825-11503847 CAGCAGGGGAGGGTGGAAGATGG - Intronic
1036880690 8:12509685-12509707 TAGCAGGAGTGGAGCCAAGATGG - Intergenic
1036962834 8:13264584-13264606 GAGCGGGAGAGGAGGGAAGGAGG + Intronic
1037339817 8:17832286-17832308 CAGAAGGAACGGAAGGAGGAAGG + Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037883743 8:22585649-22585671 CAGCAGGATGGGAGGGGAGGGGG - Intronic
1037921599 8:22810204-22810226 CAGCAGCAGCGGAAGGAAGTAGG - Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1037966501 8:23138141-23138163 CAGCAGGAGGACAGGGAATAGGG - Intronic
1038339530 8:26673896-26673918 GAGGAGGAGGGGAGGGAGGAAGG - Intergenic
1039165517 8:34675307-34675329 CAGCAGGAGGCTAGGGAAGGAGG - Intergenic
1039255381 8:35712907-35712929 CAGCAGGAGATGAGGAAAAATGG - Intronic
1039397670 8:37240940-37240962 AAGCAGGAGGGAAGGGAGGAGGG + Intergenic
1039482543 8:37885372-37885394 GATCAGGAGGGGTGGGAAGATGG - Intronic
1040905926 8:52469890-52469912 CAGGAGGGGAGGAGGGGAGAGGG - Intergenic
1040937475 8:52796293-52796315 CAGCAGGAGAGGTGAGAAGAGGG - Intergenic
1041041739 8:53853480-53853502 CAGCAGCAGGTGAGGGTAGAAGG + Intronic
1041330480 8:56719109-56719131 GGGCAGGAGGAGAGGGAAGAGGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1042137370 8:65645005-65645027 CCGGAGGAGCTGAGGGAAGTCGG + Intronic
1042722552 8:71841826-71841848 GAGCAGGAGCGGGGCGGAGAGGG + Exonic
1042932023 8:74023203-74023225 CACCAGGAGCAGAGGGTAGCAGG - Intronic
1042960114 8:74294239-74294261 GAGCAGGAGCTGAGGGCAGGTGG - Intronic
1043635051 8:82375011-82375033 AAGCAGGTGTGGAGGGAGGAAGG + Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045215535 8:100145517-100145539 CACCAGGAGCGGAGGAGTGAGGG + Intronic
1045325142 8:101112362-101112384 CAGCAGGAGCGGAGGCCAGGAGG + Intergenic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1046462045 8:114552132-114552154 CAACTGGAGTGGAGTGAAGAAGG - Intergenic
1046605349 8:116365535-116365557 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1047061799 8:121235636-121235658 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061806 8:121235652-121235674 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061813 8:121235668-121235690 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047618724 8:126585093-126585115 TGGAAGGAGAGGAGGGAAGACGG - Intergenic
1047907001 8:129483131-129483153 AAGGAGGAGAGGAGGGAAGGGGG + Intergenic
1048743378 8:137586818-137586840 CACCACGAGCCAAGGGAAGAAGG + Intergenic
1049268571 8:141682382-141682404 CAGCAGGCGCTGATGGAAGCTGG - Intergenic
1049734088 8:144194549-144194571 AACCAGGAGGGAAGGGAAGATGG + Intronic
1049749543 8:144276735-144276757 CAGCATGGTCGGGGGGAAGAAGG + Intronic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1049920831 9:362602-362624 CAGCAGGAGAGAAGGAAAGAGGG - Intronic
1051774880 9:20622359-20622381 GCCCAGGAGCGGAGGGTAGATGG + Exonic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1052739778 9:32382333-32382355 TAGCAGGTGTGGTGGGAAGAGGG + Intergenic
1053009425 9:34624813-34624835 CAGCTGGAGCGGTGGGAGGCAGG + Intronic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053314601 9:37040929-37040951 CAGCTGGCGTGGAGGGGAGAGGG + Intergenic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053575557 9:39355561-39355583 CAGCAGGAGGGGGAGGAGGAGGG - Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1056786368 9:89595182-89595204 CAGCAGGAGCAGAGGCGAGCTGG + Intergenic
1056950319 9:91036312-91036334 CCCCAGGAGGGGAGGGCAGAAGG - Intergenic
1057164911 9:92917770-92917792 CTGCAGGAGGGAAGGGAATAAGG - Intergenic
1057466963 9:95323157-95323179 AAGCAGGAGAGAGGGGAAGAGGG - Intergenic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1057702991 9:97376986-97377008 GAGCAGGGGTGGAGGGATGAAGG - Intronic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058641347 9:107088702-107088724 CAGCAGGAGAGGAGGTATGGTGG - Intergenic
1059316252 9:113428185-113428207 CAGCAGCAGCAGATGGAAAAAGG + Exonic
1059326342 9:113506167-113506189 CAGCAGTAGGGGAGGCAAGCAGG + Intronic
1059502318 9:114765823-114765845 GAGCGGGAGAGGAGTGAAGAGGG - Intergenic
1059955504 9:119511617-119511639 CAGCAGGAAAGGAGGCGAGAAGG - Intronic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060859044 9:126938886-126938908 CAGGAGTAGAGGAGGGAGGAGGG + Intronic
1061264434 9:129497131-129497153 GAGCAGGAGAGGAGGGGAGAAGG + Intergenic
1062185754 9:135217634-135217656 AAGGAGGAGGGGAGGAAAGAAGG - Intergenic
1062366620 9:136212633-136212655 CGGCAGGAGAGCAGGGCAGACGG - Intronic
1062386595 9:136314304-136314326 CAGCAGGAGGGCAGGGAGCAGGG - Intergenic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1062501887 9:136855240-136855262 CAGGAGGATCTGAGGGCAGAGGG - Exonic
1062729809 9:138102631-138102653 CAGCAGGAGGGGAGCGGGGAGGG - Intronic
1186206359 X:7204823-7204845 AAGGAGGGGAGGAGGGAAGAAGG - Intergenic
1186430696 X:9501913-9501935 CAGAAGGCGCGGAGGGCGGAGGG - Intronic
1186452883 X:9687920-9687942 CAGGAGAAGCGCAGGGAAGTGGG - Intronic
1186473957 X:9842823-9842845 AAGCAAGAGGGGAGGGAAGGAGG - Intronic
1187172938 X:16869793-16869815 CTGGAGGAGGGAAGGGAAGAGGG + Exonic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1189243155 X:39541191-39541213 CAGCAGGAGGGTGGGGATGAGGG - Intergenic
1189309323 X:40008912-40008934 CAGCGGGAGCCGCGGGAGGAAGG - Intergenic
1189364812 X:40380313-40380335 CAGCTGGAGGGGAGGCAAGGTGG + Intergenic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190598570 X:52068334-52068356 GAGGAGGAGCGGGGGGGAGACGG + Intronic
1190610254 X:52185739-52185761 GAGGAGGAGCGGGGGGGAGACGG - Intronic
1191678816 X:63819845-63819867 CAGCATGAACGGTGGGAGGAGGG - Intergenic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192888056 X:75358036-75358058 CTGGTGGAGCGGAGGGAAAATGG + Intergenic
1195505624 X:105653498-105653520 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1195845172 X:109219795-109219817 CAGCAGGGACTGAGAGAAGAGGG + Intergenic
1195997863 X:110749373-110749395 CTGCAGGAGGGGGAGGAAGAGGG - Intronic
1196124282 X:112082691-112082713 GAACAGGAGCAGAGGGAAGCCGG - Exonic
1196149348 X:112355336-112355358 CAAAAGGAAAGGAGGGAAGAAGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197721543 X:129748011-129748033 GAGCAGGAAGGGAGGAAAGAAGG + Intronic
1197870473 X:131058541-131058563 CAGCAGGAAGGGAGGCAAGGGGG - Intronic
1197984202 X:132250102-132250124 CAGCATGAGCGACGAGAAGATGG - Intergenic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1200124083 X:153805080-153805102 CAGCAGGTGAGGAAGGAAAAGGG - Exonic
1200413990 Y:2889336-2889358 AAGGAGGGACGGAGGGAAGAAGG - Intronic