ID: 965551341

View in Genome Browser
Species Human (GRCh38)
Location 3:169967376-169967398
Sequence AGATCCCTGCCTAGGCCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965551341 Original CRISPR AGATCCCTGCCTAGGCCCCG AGG (reversed) Intronic
901755831 1:11440955-11440977 GGATCCCTGCCTTGGCCTGGTGG + Intergenic
901903991 1:12392202-12392224 AGATCCTTGGCTGGGCCCGGTGG + Intronic
902089680 1:13893216-13893238 AGAGCGCTGCCCAGGCCCCGCGG - Intergenic
903565825 1:24264902-24264924 AGGTCCTGGCCCAGGCCCCGTGG - Intergenic
905800936 1:40842141-40842163 AGATCCCTGGCCAGGCACGGTGG - Intergenic
905880225 1:41458225-41458247 ACAGCCCTGCCTCGGCCCCCAGG + Intergenic
908111172 1:60899088-60899110 ACATCACTGTCTAGGCCCCCAGG - Intronic
908393784 1:63706701-63706723 ATCTCCCTGCCTAGGACCCTGGG + Intergenic
909465822 1:75972890-75972912 AGATCCCTGGCCAGGCACAGTGG - Intergenic
916195105 1:162215236-162215258 AGTGCCTTGCCAAGGCCCCGGGG + Intronic
916742183 1:167655618-167655640 AGAGCCCTGCCTTGCCCCCCAGG - Intronic
918102663 1:181390118-181390140 ATAGCCCTGCCTAGGCTCAGGGG - Intergenic
918739015 1:188103413-188103435 AAGTCTCTGCCTAGGCCCCTAGG + Intergenic
923549765 1:234954307-234954329 AGATGCCTGCCTGTTCCCCGTGG - Intergenic
1062938680 10:1406274-1406296 AGCTCCCTGCCTGAGCCCCTGGG - Intronic
1069346634 10:67477354-67477376 AGCTCCCTGCTTTGCCCCCGGGG - Intronic
1072067339 10:91883932-91883954 CGTTCCCTGCCTGGTCCCCGTGG + Intergenic
1073052928 10:100680977-100680999 AGATCCCAGCCCAAGCGCCGGGG - Intergenic
1075528117 10:123202963-123202985 AGGCCCCTGCCTAGGCTCCATGG - Intergenic
1076587530 10:131559706-131559728 AGCTCCATGCCTGGGCCCCCAGG - Intergenic
1077050308 11:563456-563478 GGTGCCCAGCCTAGGCCCCGAGG + Exonic
1077473739 11:2776782-2776804 AGATCCCTGCTCAGCCCCCTCGG + Intronic
1078463754 11:11535095-11535117 AGATCCCTTCCAAAGTCCCGTGG + Intronic
1079483587 11:20910255-20910277 AGTTCCCAGCCTAGGCCTCAAGG - Intronic
1083188880 11:61035417-61035439 CCAGCCCAGCCTAGGCCCCGGGG - Intergenic
1083198736 11:61106531-61106553 AGGTCCCTTCCTGGGCCCCCAGG - Intronic
1083511301 11:63211422-63211444 AGATTCCTGCTGAGGCCACGTGG + Intronic
1083809593 11:65096267-65096289 AGACCCCGGGCTAGGCCCGGCGG - Exonic
1084150814 11:67287143-67287165 AGGTCCCTGCCCTAGCCCCGCGG + Intergenic
1084728587 11:71058814-71058836 AGACCCCAGCCCGGGCCCCGGGG + Intronic
1084801969 11:71549955-71549977 ACATCCCTTCCTAGGCACTGAGG - Intronic
1086372793 11:86171657-86171679 AGATTCCTGCCTAGGGTCCCAGG - Intergenic
1088831075 11:113537367-113537389 AGAGCCCTGCCTAGGACTCCAGG - Intergenic
1091059717 11:132450095-132450117 AGCACCCTGCCCAGGCCCCAGGG + Intronic
1091604052 12:1935453-1935475 AAGACCCTGCCCAGGCCCCGAGG - Intergenic
1094809484 12:34123773-34123795 AGATTCCTGCTGAGGCCGCGTGG - Intergenic
1097043698 12:56171793-56171815 AGAGGCCTCCCTAGGCCCCCTGG - Exonic
1098208712 12:68139474-68139496 AGGTCCCTGCATATGCCCCATGG - Intergenic
1101725569 12:107385661-107385683 AGGTCCTTGCCCAGGCCCCCTGG + Intronic
1104932056 12:132345101-132345123 AGATGCCTGCCAGGGGCCCGCGG - Intergenic
1105022239 12:132824750-132824772 AGATCCCTGCCTAGGCTCTAAGG - Intronic
1105440806 13:20414474-20414496 AGATTTCTGCCTAGGACCCAGGG + Intronic
1106266530 13:28114958-28114980 AGATACCTGGCCAGGCACCGTGG - Intergenic
1112012044 13:95301034-95301056 TGGTCCCTGCCTGCGCCCCGGGG - Intronic
1112815026 13:103263522-103263544 AGGTCCATCCCTAGGCCCCCAGG + Intergenic
1114574698 14:23701302-23701324 AGTTCTCTGCCTGGGCCCTGAGG - Intergenic
1120241353 14:81953220-81953242 AGTTCTCTGCCTGGGCCCTGGGG + Intergenic
1121585228 14:95058717-95058739 AGATCCTTGCTGAGGCCTCGGGG - Intergenic
1123033868 14:105463896-105463918 AGATCCCTGCCGAGGCCGAGGGG + Intronic
1123435370 15:20250376-20250398 AAATCCCTGGCCAGGCACCGTGG + Intergenic
1124161159 15:27271388-27271410 AGCTCCCTGCGTAAGACCCGTGG - Intronic
1126323341 15:47448230-47448252 AGATCCCGGCCCAGGCGTCGTGG - Intronic
1127103085 15:55587684-55587706 GGATCGCAGCCTCGGCCCCGGGG + Intronic
1127256220 15:57296200-57296222 AGATACCTGCCTAGGCCATGAGG + Intronic
1130124980 15:81085650-81085672 AGACCCCTTCCAAGGCCCTGGGG + Intronic
1130316963 15:82804269-82804291 ATATCTCTGCCTGGGCCCCCTGG - Intronic
1131131677 15:89904473-89904495 AGAACCCTGCCTGGCCACCGGGG - Intronic
1132337342 15:101056810-101056832 AGGTCGCTGCCTGGGCCCAGTGG - Intronic
1132508554 16:325052-325074 AGATCACAGCCTCAGCCCCGCGG + Intronic
1133736737 16:8621750-8621772 GGATCCCAGGCTGGGCCCCGCGG + Exonic
1135383568 16:22014569-22014591 AGATCCCAGCCTATGCACTGGGG + Intronic
1136055242 16:27683469-27683491 AGAGGCCTGCCTGGGGCCCGAGG + Intronic
1137765448 16:50974294-50974316 AGATCCCAGCCTTGGCCTCCAGG - Intergenic
1138248997 16:55488252-55488274 AGAACCCTGCCTCAGCCCCAAGG - Intronic
1139606691 16:68023660-68023682 AGACCCCTGTCTCGGCCCCTAGG - Intronic
1141650447 16:85390029-85390051 GAATCCCAGCCTAGGCCCCGAGG - Intergenic
1141957871 16:87384370-87384392 AGCTCCCTGCGGAAGCCCCGGGG + Intronic
1142242081 16:88952177-88952199 AGATACCTGGCCAGGCCCCAGGG + Intronic
1143450248 17:7031996-7032018 AAGTCCCTGCCTGGGCCCCTAGG + Intergenic
1143787866 17:9269783-9269805 CGATCCCTGCCAAGGCACAGAGG - Intronic
1146370594 17:32263679-32263701 AGATCCCTGGCCAGGCGCGGTGG - Intergenic
1147990379 17:44329006-44329028 AGATGTCTTCCTAGGCCCTGGGG - Intergenic
1148134772 17:45285081-45285103 AGATCCCTGCCTTCGCCCCAGGG - Intronic
1151426976 17:74037362-74037384 CGAGCCCTGCCCAGGCCCCTGGG - Intergenic
1151975821 17:77483070-77483092 AGACCCCTCCCTGGACCCCGTGG - Intronic
1153979198 18:10294935-10294957 AGAGGCCTGCCTAGGCTCTGAGG - Intergenic
1155512238 18:26589708-26589730 AGACCCCTCCCTAGCCCCAGTGG + Intronic
1158702960 18:59765757-59765779 AGTTTCCTGCCTAGGCCAGGTGG + Intergenic
1160465082 18:79069493-79069515 GGCTCCCGGCCTGGGCCCCGCGG - Exonic
1160696049 19:484974-484996 AGCCCCCAGCCCAGGCCCCGTGG - Intergenic
1160844474 19:1160352-1160374 ACACCCCTGCCCAGGCCTCGGGG + Intronic
1161466487 19:4433439-4433461 AGTGCCCTGGCTGGGCCCCGTGG - Exonic
1162780769 19:13006038-13006060 TGCTCCCTGCCGAGCCCCCGGGG - Intronic
1163660654 19:18575173-18575195 AGCCTCCTGCCCAGGCCCCGTGG + Exonic
1163666907 19:18607521-18607543 AGCTCCCTCCCGAGGCCCCCGGG - Intronic
1164590464 19:29504089-29504111 AGAGCCATGCAAAGGCCCCGGGG - Intergenic
1164781515 19:30897056-30897078 AGATCACTGGCTGGGCCCCTTGG + Intergenic
1164988760 19:32669302-32669324 TAATCCCTGCCTGGGCCCCAGGG + Intronic
1165548340 19:36561546-36561568 AGGTCTCTGTCTAGGCCCTGAGG - Intronic
1166733051 19:45069363-45069385 AGATCCCTGCCTGGCCCTCGGGG + Intronic
1167796727 19:51714141-51714163 AGAATCCTGCCCAGGCCCCAGGG - Intronic
925149346 2:1603763-1603785 CCATCCCTGCTTAGCCCCCGGGG - Intergenic
925875150 2:8305065-8305087 AGATCCCTGGCTAGACACCGAGG + Intergenic
926936260 2:18088860-18088882 AGATCCCTGCATGGGCCACCAGG + Intronic
927964837 2:27262392-27262414 AGCTCCCTCTGTAGGCCCCGGGG - Intronic
928103143 2:28451103-28451125 AGGTCCCAGGCTAGGCCCCGGGG - Intergenic
929555649 2:42924111-42924133 TGAACCCTGCCAAGGCCCTGTGG - Intergenic
930604039 2:53473943-53473965 AGAGCCCTGACTAGGGCCCTGGG + Intergenic
932641824 2:73455687-73455709 AGATGCCTGCCTAGGCACAGTGG - Intronic
933363886 2:81324346-81324368 AGCTCCCTGCTTAGTCCCAGGGG + Intergenic
934562057 2:95318488-95318510 ACATCCCTGCCAAGGCCTCCAGG - Intronic
937429773 2:121828522-121828544 ATATCCCTGCCGAGCCCTCGTGG - Intergenic
942324783 2:174766892-174766914 AGGTTCCTGGCTATGCCCCGGGG - Intergenic
947643515 2:231721167-231721189 AGCTCCCTGCCTAGCCCTAGTGG - Intergenic
948207307 2:236168862-236168884 AGCTCCCAGCCTTCGCCCCGGGG - Intergenic
948757682 2:240168856-240168878 AGAGCCCTGCTTGGGCCCCTGGG - Intergenic
948853652 2:240720156-240720178 GGCTCCCTGGCTGGGCCCCGAGG - Intronic
1168877335 20:1180756-1180778 TGACCCCTGCCAAGGCCCTGGGG - Exonic
1169265811 20:4166814-4166836 ACATGCCTGCCAAGGCCCCCTGG + Intronic
1170538646 20:17366078-17366100 AGTTCTCTGCCTGGGCCCCGAGG + Intronic
1171371234 20:24663543-24663565 AGAGCCCAGCCCAGGCCCCAGGG + Intronic
1172837186 20:37880766-37880788 AGACCCCTCCCTCGGCCCCATGG + Intergenic
1172916504 20:38447452-38447474 TTTTCCCTGCCTAGGCCTCGTGG + Intergenic
1175247502 20:57590780-57590802 AGATCCTTGTCCAGGCCCCATGG + Intergenic
1177372191 21:20218588-20218610 GGATCCCTGCCTGGACCCCAAGG - Intergenic
1178737975 21:35169915-35169937 TGATCCCTGTCTAGGTCCTGGGG + Intronic
1183679651 22:39320254-39320276 TGATCTCTGCCTAGGCTCCAGGG + Intronic
1183777978 22:39980317-39980339 AGAGCCCTGCCTAGGTTCCCAGG - Intergenic
1184118912 22:42437908-42437930 AAATCCCTTCCTGGGCACCGCGG + Intergenic
1184435660 22:44473642-44473664 ATTTCTCTGCCTGGGCCCCGAGG - Intergenic
1185067584 22:48639849-48639871 AGAGCCCTGCCCAGACCCTGGGG - Intronic
954214565 3:49117169-49117191 TGGGCCCTGCCTGGGCCCCGGGG + Exonic
954390607 3:50266321-50266343 AGATCCCTGCCTGGGCTCGTGGG - Intergenic
954705888 3:52480332-52480354 ACAGCCCTGCCTGGGCCCCCTGG + Intronic
954722471 3:52577141-52577163 ATATCCCTGGCTGGGCCCAGGGG + Intronic
955404526 3:58617611-58617633 AGCTCCCTCCCTGGGCCCCAGGG - Intronic
958070047 3:88598153-88598175 AAGTCTCTGCCTGGGCCCCGAGG + Intergenic
962308729 3:134311263-134311285 AGACCCCTACCTGGGCCCAGTGG + Intergenic
965551341 3:169967376-169967398 AGATCCCTGCCTAGGCCCCGAGG - Intronic
966823090 3:183940561-183940583 AAAGCCCTGCCTCGGCCCAGAGG - Intronic
969134649 4:5020124-5020146 AGCTCCCAGCACAGGCCCCGAGG + Intergenic
969409146 4:7016434-7016456 AGATTCCTGGCTGGGGCCCGCGG + Intronic
972611395 4:40658889-40658911 AGATTCATGCCTAGGCCACCTGG + Intergenic
975735593 4:77377670-77377692 CTAGCCCTGCCTAGGCCCAGAGG - Intronic
978478283 4:109157779-109157801 AGCTCCCTGCTTATGCCCAGGGG + Intronic
979018771 4:115468179-115468201 AAATCTCTGCCTGGGCCCCTAGG - Intergenic
979069701 4:116186142-116186164 AGCTCTCTGCCTGGGCCCTGAGG + Intergenic
981538569 4:145825146-145825168 GGCTCCCTGGCCAGGCCCCGTGG - Intronic
982273981 4:153621226-153621248 AGAGGCCTGCCTGTGCCCCGTGG - Intronic
989061165 5:37413433-37413455 AGATTCCTGACTGGGCACCGTGG + Intronic
997585281 5:135039934-135039956 GGACCCCAGCCTACGCCCCGAGG - Intronic
998029890 5:138857290-138857312 AGCTCCCTTCCTAGCCCCAGAGG + Intronic
1001279367 5:170375495-170375517 AGCTCCCTGCCTGGCCCCTGTGG + Exonic
1004445469 6:15693701-15693723 TGATCCCTGGCTGGGCGCCGTGG + Intergenic
1006594819 6:35185418-35185440 ATAGCCCTGCCGAGGCTCCGGGG + Intergenic
1009050354 6:58267732-58267754 AGATCTCTGCTTAGGACCCCAGG - Intergenic
1013372460 6:109482982-109483004 ACCTCCCCGCCCAGGCCCCGCGG + Intronic
1018101808 6:160446903-160446925 ACATCCCTGCCTGGGCCACTGGG - Intronic
1021572825 7:22083051-22083073 CGACACCTGCCGAGGCCCCGCGG + Intergenic
1021765466 7:23943996-23944018 AGCACTCTGCCTAGGGCCCGAGG + Intergenic
1024216803 7:47255161-47255183 ACATCCCTGCCTGGGCCACAGGG + Intergenic
1026131568 7:67625417-67625439 AGCTCCCTGCAGAGGCCCCCGGG + Intergenic
1026928091 7:74207622-74207644 AGACCCCTGCAGAGGCCACGAGG + Intronic
1029454945 7:100664884-100664906 TGATTTCTGCCTAGGCCCCATGG + Intergenic
1030515672 7:110534679-110534701 CTAACCCTGCCCAGGCCCCGGGG - Intergenic
1033832132 7:145267479-145267501 AGTTCTCTGCCTGGGCCCTGTGG - Intergenic
1038491099 8:27972027-27972049 AGATACCTGGCTGGGCCCGGTGG + Intronic
1041724415 8:61004765-61004787 AGGCCTCTGCCTGGGCCCCGCGG + Intergenic
1044758339 8:95490364-95490386 AGATCCCTGCCTATGTCACAAGG - Intergenic
1047700572 8:127445574-127445596 AGTTCTCTGCCTACGCCCCAAGG - Intergenic
1047931069 8:129728571-129728593 AGCTCCCTGCTTAGCCCCTGGGG - Intergenic
1048998679 8:139810318-139810340 TCATCCCTGCCCATGCCCCGTGG - Intronic
1049036102 8:140077504-140077526 AGATCCCAGCCTGAGCCCCAGGG + Intronic
1049409454 8:142465973-142465995 AGAGCCCTGTGGAGGCCCCGTGG + Intronic
1056693194 9:88825415-88825437 AGGTCTCTGCCTTGGCCCTGTGG - Intergenic
1057305791 9:93911261-93911283 AGATGCCTGCCCAGGCCTCGGGG + Intergenic
1057753253 9:97809399-97809421 AGATGCCTGGCCAGGCTCCGGGG + Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061466877 9:130787502-130787524 AGATCTTTGCCTGGGTCCCGGGG + Intronic
1062435910 9:136546480-136546502 AGAGCCCTGCCCCGGGCCCGGGG - Intergenic
1062618976 9:137411118-137411140 AGATTCCGGCTGAGGCCCCGAGG + Intronic
1186157484 X:6740664-6740686 AGATCCCTGAGAAGGCCCAGAGG + Intergenic
1186867522 X:13734944-13734966 AGAACCCTGCCTCTGTCCCGAGG - Exonic
1189254104 X:39624026-39624048 ACTTCTCTGCCTAGGCCCCAAGG + Intergenic
1191087830 X:56588121-56588143 AGATCCCTGCTTAGCCCTGGTGG + Intergenic
1193501239 X:82277210-82277232 AGGTCTCTGCCTAAGCCCCAAGG - Intergenic
1195140752 X:101957018-101957040 AGATACCTGCCTAGGACTCCTGG - Intergenic
1195756446 X:108203594-108203616 ATTTCCCTGCCTAGGCCCCTTGG + Intronic
1198233247 X:134713764-134713786 GGATCCCAGCCTAGGCACGGAGG - Intronic
1199343261 X:146707939-146707961 AGCTCCCTGCTTAGCCCCAGGGG + Intergenic
1199609073 X:149598481-149598503 GCATCCCTAACTAGGCCCCGTGG - Intronic
1199630046 X:149770876-149770898 GCATCCCTAACTAGGCCCCGTGG + Intergenic
1200061256 X:153484783-153484805 AGCCCCCTGCCCAGGCCTCGTGG - Intronic