ID: 965560762

View in Genome Browser
Species Human (GRCh38)
Location 3:170060374-170060396
Sequence AAACGGATGCTAAAACTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965560757_965560762 10 Left 965560757 3:170060341-170060363 CCCAGTGTGGTGATTAATTCAGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 965560762 3:170060374-170060396 AAACGGATGCTAAAACTATCAGG 0: 1
1: 0
2: 2
3: 14
4: 185
965560759_965560762 9 Left 965560759 3:170060342-170060364 CCAGTGTGGTGATTAATTCAGGC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 965560762 3:170060374-170060396 AAACGGATGCTAAAACTATCAGG 0: 1
1: 0
2: 2
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965560762 Original CRISPR AAACGGATGCTAAAACTATC AGG Intronic
900010466 1:102618-102640 AAACTCATGCCAAAACTTTCAGG + Intergenic
900026570 1:279183-279205 AAACTCATGCCAAAACTTTCAGG + Intergenic
900036356 1:413026-413048 AAACTCATGCCAAAACTTTCAGG + Intergenic
900057984 1:648781-648803 AAACTCATGCCAAAACTTTCAGG + Intergenic
900904477 1:5543490-5543512 AAAAGGACTCTAAAAATATCAGG + Intergenic
901517922 1:9761870-9761892 AAACTGATTGGAAAACTATCAGG + Intronic
902261813 1:15231231-15231253 CAAAGAATGCTAAAACTATTAGG + Intergenic
905607273 1:39313371-39313393 CAATGGATGCTAAAACTAGTTGG - Intronic
905714774 1:40139434-40139456 TAATGGATGCTAAAACTACTAGG - Intergenic
905780037 1:40700839-40700861 AACAGGATGCTAAAGTTATCTGG - Intronic
908540177 1:65114679-65114701 AAAAGGAAGCAAAAACTCTCTGG - Intergenic
909218452 1:72922527-72922549 AAAGTGATGCTATAATTATCGGG + Intergenic
909419586 1:75449363-75449385 AAAGGGAAGCTAATATTATCAGG - Intronic
911801996 1:102152543-102152565 TAATGGATGCTAAAACTAGTGGG - Intergenic
917829618 1:178866379-178866401 CATGTGATGCTAAAACTATCTGG - Intronic
918581861 1:186140650-186140672 AAATGGATGCTAAAACTAGTGGG - Intronic
919569767 1:199233000-199233022 AAACTGATTCTAAAATTATATGG + Intergenic
919970825 1:202576654-202576676 AAAGGGATACTAAAAATAACTGG - Intronic
920278286 1:204824764-204824786 GAACGAATGCTAGAACTAGCCGG + Intergenic
922258904 1:223918624-223918646 AAACTCATGCCAAAACTTTCAGG + Intergenic
923172081 1:231426833-231426855 TAATGGATGCTAAAATAATCAGG - Intergenic
923870124 1:237983318-237983340 GAACTGATGTTAAAACCATCAGG - Intergenic
923981749 1:239332193-239332215 AAACGCCTGATAAAACTGTCAGG - Intergenic
1065090758 10:22230882-22230904 TAATGGGAGCTAAAACTATCAGG + Intergenic
1071735283 10:88291964-88291986 AATTGTATGCTAAAAATATCAGG + Intronic
1073131753 10:101193629-101193651 CAATGGATGCTAAAACTATTGGG + Intergenic
1073374964 10:103025496-103025518 TAACAGATGCTAAAACTATTAGG - Intronic
1073882777 10:108002780-108002802 AAAGGAATGTTGAAACTATCTGG - Intergenic
1078435763 11:11323992-11324014 ATAAGGATGCTAATCCTATCAGG - Intronic
1078573708 11:12481142-12481164 AAATGGATGCAAAAACTAGAGGG - Intronic
1078951453 11:16139281-16139303 GAAGGGATGCTAAAACTATTGGG - Intronic
1080629774 11:34063428-34063450 AAAAGGTAGCTAAACCTATCAGG - Intronic
1081276565 11:41156864-41156886 AAACTCATGCTGAAACTACCAGG + Intronic
1081598864 11:44477965-44477987 AAACCCCTGATAAAACTATCAGG - Intergenic
1084731780 11:71078453-71078475 CAATGGATGCCAAAACTGTCAGG + Intronic
1084984734 11:72858780-72858802 AAGATGATGCTAAAAATATCAGG + Intronic
1086797806 11:91130398-91130420 TAAAAGATCCTAAAACTATCAGG - Intergenic
1086953177 11:92911179-92911201 AAAAGAAAACTAAAACTATCAGG - Intergenic
1087448044 11:98280104-98280126 AAATGCAAGCTAAAACTGTCAGG - Intergenic
1088424034 11:109681698-109681720 TAACAGATCCTAAAACTATTTGG + Intergenic
1094131121 12:27076467-27076489 AAATAGATGCTAAAACCATTGGG - Intergenic
1094180564 12:27588314-27588336 AAATAGATGCTAAAACCATTGGG - Intronic
1095222053 12:39627207-39627229 AAGTGCATGCTAAAATTATCAGG - Intronic
1095758667 12:45801376-45801398 CAATGGATGCTAAAACTAGCAGG + Intronic
1096225281 12:49862416-49862438 CAATGGATGCTAAAACTCTTAGG - Intergenic
1097373938 12:58818474-58818496 AAACACATGCAAAACCTATCAGG - Intergenic
1098871005 12:75816877-75816899 CAACGGATGCTAAAGCTATAGGG + Intergenic
1099068561 12:78015741-78015763 CAACGGATGCTAAAACTTGTGGG - Intronic
1100389294 12:94133625-94133647 ACAGGGATGGTAAAACTTTCTGG + Intergenic
1102971378 12:117170384-117170406 AAACTGATTCTAAATCTATACGG + Intronic
1104393506 12:128411292-128411314 AAGAGGATGCTAAAACTATCCGG - Intronic
1104443323 12:128813065-128813087 ACACGGATACTAAAACTTTAAGG + Intronic
1107854014 13:44597219-44597241 GCACGGATGCTAGAACTAGCTGG + Intergenic
1108244930 13:48504580-48504602 AAACGGATGCATAAAGTAACAGG - Intronic
1108671501 13:52694568-52694590 AAACAGAAGGTAAAACTATTAGG + Intronic
1109677411 13:65696032-65696054 AAACAGAAGTTAAAAATATCAGG - Intergenic
1111168063 13:84489358-84489380 AAACGCGTGGTAAAGCTATCTGG - Intergenic
1111561314 13:89951891-89951913 AACCAGATCCTAAAATTATCTGG - Intergenic
1111573026 13:90112958-90112980 AAATGGTGGCTAAAACTATAAGG + Intergenic
1111642647 13:90989326-90989348 AAACAGATCCTAATAGTATCTGG + Intergenic
1112969894 13:105247821-105247843 TAAGTGATGCTAAAACTACCAGG - Intergenic
1114927137 14:27417667-27417689 CCACCGATGCTAAAACTATTGGG + Intergenic
1117339959 14:54784309-54784331 AAACGGAGACTAAAAATAGCTGG - Intronic
1117652081 14:57917805-57917827 AAATGGATTGAAAAACTATCTGG - Intronic
1117880813 14:60311850-60311872 AAACTGATGCTAAAACTGGTGGG - Intergenic
1121594572 14:95150628-95150650 TAATGGATGCTAAAACCATTGGG + Intronic
1123131344 14:105988012-105988034 AAAGGGAGGCTAAAACTCTGGGG + Intergenic
1123581577 15:21719212-21719234 AAAGGGAGGCTAAAACTCTGGGG + Intergenic
1123618226 15:22161835-22161857 AAAGGGAGGCTAAAACTCTGGGG + Intergenic
1126291893 15:47090450-47090472 TAATGAATGCTAAAACTATTAGG - Intergenic
1129598861 15:76985698-76985720 CAACGGATGCTAAAACTAGTGGG + Intergenic
1129768984 15:78191661-78191683 CAAGGGATGCTAAAACCATCAGG + Intronic
1131903461 15:97115092-97115114 AAACAGATGCTATAAATAACTGG + Intergenic
1134480357 16:14613729-14613751 CAATAGATGCTAAAACTAACTGG + Intronic
1139125777 16:64075158-64075180 AAGAGGATGCTAAGACTTTCTGG + Intergenic
1139310307 16:66022800-66022822 TAAAGGATGCTGAAACTGTCAGG - Intergenic
1140522588 16:75594525-75594547 ACACGGCTGCTAGAACCATCAGG + Intergenic
1140984503 16:80145211-80145233 AAAGGGATGCTAAAATTCTGTGG - Intergenic
1142453876 16:90204292-90204314 AAACTCATGCCAAAACTTTCAGG - Intergenic
1143462224 17:7111215-7111237 ACACGGATGCTAGAATTAGCAGG + Intronic
1146191229 17:30768514-30768536 AAAAGCATGCTAAATCTCTCTGG - Intergenic
1146336388 17:31975162-31975184 AAAAGCATGCTAAATCTCTCTGG - Intronic
1146734378 17:35225124-35225146 CAACTGATGCTGAAACTACCAGG - Intergenic
1148281222 17:46349012-46349034 CAATGGATGCTAAAACGATTAGG + Intronic
1148303450 17:46566947-46566969 CAATGGATGCTAAAACGATTAGG + Intronic
1149837303 17:59924560-59924582 AAATGGATGATAAAACCATTGGG + Intronic
1152731781 17:81976013-81976035 TAACTGATGCTAAAACTGTTGGG + Intergenic
1153336154 18:3927203-3927225 CAATGGATGCTAAAACTAGTGGG + Intronic
1153432361 18:5031643-5031665 CAAAGGATGCCAAAACTATTGGG - Intergenic
1155402082 18:25449898-25449920 CAATAGATGCTAAAACTATTAGG + Intergenic
1155496992 18:26452428-26452450 CAATGGATGTTAAAACCATCTGG + Intergenic
1155894849 18:31312046-31312068 AAACGAATGCAAAAATTAGCTGG - Intergenic
1159743383 18:72200965-72200987 ACACAGATGTTGAAACTATCAGG + Intergenic
1164327328 19:24207638-24207660 AAACGAATGCTTAAACTCTGTGG + Intergenic
1164809466 19:31144826-31144848 AAAGGGATGTAAAAACTTTCTGG - Intergenic
1165889990 19:39106036-39106058 GAATGGATGATAAAACTAGCAGG - Intronic
925613983 2:5727819-5727841 TAATGGAAGATAAAACTATCAGG - Intergenic
928361902 2:30670294-30670316 GCACGGATGCTGGAACTATCAGG - Intergenic
929198592 2:39211727-39211749 CACTGGATGCTAAAACCATCAGG + Intronic
931424364 2:62157503-62157525 AAACAGATGCTAACTCAATCTGG + Intergenic
931718648 2:65049970-65049992 TAATGAATGCTAAAACTATTGGG - Intergenic
931738509 2:65220492-65220514 TAATGGCTGCTAAAACTATTAGG + Intergenic
931765748 2:65454671-65454693 CAATGGATGCTAAAACTAGTGGG + Intergenic
932584534 2:73018643-73018665 CAACAGATGTTAAAACTATTGGG - Intronic
934961824 2:98682497-98682519 AAATGCATGCTAAAACTAACAGG + Intronic
935009991 2:99125505-99125527 GAACGGATGTTACAATTATCTGG - Intronic
936272624 2:111060687-111060709 ACAGTGATGCTAAAATTATCTGG + Intronic
939427733 2:142061227-142061249 AAACGGATAACAAAAATATCTGG + Intronic
940128219 2:150351808-150351830 AAACGAATGCAAAAATTAGCCGG - Intergenic
941744834 2:169076007-169076029 CAATGGATGCTAAAACTAGTGGG - Intronic
944043771 2:195385371-195385393 AAACTCAGGCTAAAACTAGCTGG - Intergenic
946690415 2:222305017-222305039 AAACGAAATCTAATACTATCTGG + Exonic
949085327 2:242148955-242148977 AAACTCATGCCAAAACTTTCAGG - Intergenic
1170677116 20:18492708-18492730 AAATGGATGCCAAAACGATTGGG - Intronic
1170690782 20:18613376-18613398 AAACTGTTGCTAAAACTCTCAGG + Intronic
1170840297 20:19919943-19919965 ACACCAATGCTAAAACTAACTGG + Intronic
1171537468 20:25908095-25908117 TAATGAATGCTAAAACTATTAGG + Intergenic
1171803598 20:29652555-29652577 TAATGAATGCTAAAACTATTAGG - Intergenic
1174311994 20:49663940-49663962 CAATGGATGCTAAAACCCTCAGG + Intronic
1179331808 21:40410054-40410076 AAACAGATGATAAAATTAACAGG + Intronic
952496804 3:33923339-33923361 AAAAGGATGGGAAAACTATTTGG - Intergenic
952864765 3:37846982-37847004 CAACAGATGCTAAAACTAGAGGG + Intergenic
953515024 3:43582080-43582102 AGACAGATGATAAAAATATCAGG + Intronic
956906059 3:73766574-73766596 AGATGGCTGCTAAAATTATCTGG + Intergenic
956984765 3:74686099-74686121 AAATAGATGCTAAAACTAATGGG - Intergenic
957284119 3:78195169-78195191 CAATGGATCCTAAAACTATTAGG - Intergenic
961119232 3:124359371-124359393 AAAGGGATGAAATAACTATCTGG - Intronic
961310269 3:125993514-125993536 CAATGGATGCTAAAACTATGGGG + Intergenic
963255607 3:143141841-143141863 CAGCGGATGCTAAAACTAATGGG - Intergenic
965560762 3:170060374-170060396 AAACGGATGCTAAAACTATCAGG + Intronic
965823954 3:172711859-172711881 AAATGAATGCTAAAACTAGAGGG + Intergenic
969907111 4:10407443-10407465 AAGAGGATGCTAAAACCATGAGG + Intergenic
970204196 4:13639867-13639889 TGAGGGATGCTAAAACAATCTGG + Intergenic
972661857 4:41123874-41123896 AAACGATTGCTTAAACTAGCAGG + Intronic
974494628 4:62610335-62610357 TAACGGATGCTAAAAATATTTGG - Intergenic
977990456 4:103434791-103434813 TAATGGATTCTAAAACTTTCAGG - Intergenic
978535583 4:109758644-109758666 AAAAGGCTGCTAAAACCATTAGG + Intronic
979262759 4:118667203-118667225 AAACTCATGCCAAAACTTTCAGG - Intergenic
979503790 4:121470118-121470140 CAATGGATGCTAACACTATTAGG - Intergenic
979665104 4:123302785-123302807 AAACTGATCCTAAAACAAGCAGG + Intronic
980038808 4:127915460-127915482 CAATGGATGCTTAAACTATTAGG - Intergenic
980089415 4:128426704-128426726 AAACTGCTGTTAAAACTATAAGG + Intergenic
981168084 4:141586547-141586569 AAACGGAAGCCAAAAATAGCAGG - Intergenic
981704372 4:147643534-147643556 CAATGGATGCTAAAACTAGTAGG + Intronic
982554774 4:156846127-156846149 AAATGGATGCTAAAAAAATTGGG + Intronic
984244805 4:177262271-177262293 CAACTGATGCTAAAACTAGGAGG + Intergenic
984292544 4:177813594-177813616 AAATGGGTGCTAAAACCATTAGG - Intronic
988036081 5:25829148-25829170 ACAGGGATGCTAAAACTAAGAGG - Intergenic
988826725 5:34943637-34943659 CAACAGATGCTAAAGCTATGAGG - Intronic
991658346 5:68925761-68925783 CAATGGATGCTAAAACTAGTGGG + Intergenic
996494806 5:124141465-124141487 ACAGGAATGCTAAAATTATCTGG + Intergenic
997175929 5:131777937-131777959 CAATGGATGCTAAAACCATGAGG + Intronic
999728789 5:154459723-154459745 AAACGGATGCTCACATCATCAGG + Exonic
1000743759 5:165003846-165003868 GAAAGGATGAAAAAACTATCTGG - Intergenic
1002737465 5:181405838-181405860 AAACTCATGCCAAAACTTTCAGG - Intergenic
1004468650 6:15908608-15908630 AACCTGATGCTAAATCTCTCTGG - Intergenic
1004845844 6:19640914-19640936 AAATAGATGCTAAATCTATGAGG + Intergenic
1005899118 6:30202404-30202426 CAATAGATGCTAAAACTATTAGG + Intronic
1016719621 6:147280573-147280595 CAACAGATGCTAAAACTAAAGGG - Intronic
1018140973 6:160836904-160836926 AAACGGATACCAAAACTAATGGG - Intergenic
1019242562 6:170681393-170681415 AAACTCATGCCAAAACTTTCAGG - Intergenic
1024351734 7:48372944-48372966 AAACGTATGATAACACTTTCAGG + Intronic
1024706477 7:51966711-51966733 AAATTGATGCTTAAACTCTCTGG + Intergenic
1024711825 7:52023586-52023608 CAACGGTTGCTAAAACTAGTGGG + Intergenic
1024910934 7:54446145-54446167 AAATGGAAGCTAAAAATATAGGG - Intergenic
1025074833 7:55933864-55933886 AAAAAGATGCAAAAATTATCTGG - Intronic
1028917264 7:96272901-96272923 TCATGGATGCTAAAACCATCAGG + Intronic
1030647996 7:112085707-112085729 CAATGGATGCTAAATCCATCAGG + Intronic
1030866413 7:114706003-114706025 AAAGGGATGCTAAAAGGATGGGG - Intergenic
1032188028 7:129744358-129744380 CAATGGTTACTAAAACTATCAGG - Intronic
1033636178 7:143213421-143213443 ACAAGGGTGCCAAAACTATCTGG - Intergenic
1034015284 7:147577025-147577047 AAACAGTTGGTAAAACTACCTGG - Intronic
1035505558 8:126760-126782 AAACTCATGCCAAAACTTTCAGG + Intergenic
1041649685 8:60289696-60289718 AAAAATGTGCTAAAACTATCGGG + Intergenic
1042421479 8:68595191-68595213 AAGAGGATGCTAAAAGTATTTGG - Intronic
1042703547 8:71643126-71643148 AAATGGATGGGAAAAATATCTGG - Intergenic
1043729174 8:83652497-83652519 AAACAGATTCAAAAACTAGCAGG - Intergenic
1044269801 8:90228582-90228604 AAATGGATGTTAAAACCTTCTGG + Intergenic
1044491201 8:92817582-92817604 AAACGTGTGCTAAAGCTCTCTGG + Intergenic
1045457919 8:102400011-102400033 ACATGGATGCCAAAAATATCTGG + Intronic
1046130025 8:109955343-109955365 AAAAGGATGTTGGAACTATCAGG - Intergenic
1047455874 8:125010724-125010746 AAATAAATGCTAAAAATATCAGG - Intronic
1049125194 8:140780253-140780275 CAACAGCTGCTAAAACTATTAGG + Intronic
1050307354 9:4318770-4318792 CAAAAGATGCTAAAACTATTAGG + Intronic
1051558536 9:18412362-18412384 AGATGGATGCTAAAACCATTAGG - Intergenic
1051885504 9:21888639-21888661 AAATGGATGCCAAAACAAGCAGG - Intronic
1055184882 9:73439082-73439104 CAATGGATGCTAAAACTAATTGG + Intergenic
1056161797 9:83903618-83903640 ATAGGGATGCTAAAATTACCCGG - Exonic
1058502379 9:105634039-105634061 AAAAGAAAGCTAAAACTAGCAGG - Intronic
1059307383 9:113365272-113365294 CAATGGATGCTAAAACTATTGGG - Intronic
1060063162 9:120479345-120479367 AAAAGGATGCTAAAACTAGTAGG + Intronic
1062058158 9:134479717-134479739 AACCAGATGCTAAAAGTACCAGG - Intergenic
1203602753 Un_KI270748v1:30617-30639 AAACTCATGCCAAAACTTTCAGG - Intergenic
1187890468 X:23929899-23929921 AAAATTATGCTAAATCTATCCGG + Intronic
1188137433 X:26506298-26506320 CAACAGATGCTAAAACCATTAGG + Intergenic
1190124122 X:47688194-47688216 AAATGGATGCTAAAATTTGCAGG - Intergenic
1190527538 X:51343066-51343088 CAATGGATGCTATAACTATGGGG + Intergenic
1190858737 X:54323026-54323048 CAACGGATGCTAAAATCAGCGGG + Intronic
1197508608 X:127341904-127341926 AAAGGAAATCTAAAACTATCTGG + Intergenic
1198230211 X:134682121-134682143 CAACGTATGCTGAAACTATAGGG - Intronic
1198386546 X:136134535-136134557 CAATGAATGCTGAAACTATCAGG + Intergenic
1199259561 X:145755612-145755634 CAACAGATGCTAAAACTATCAGG - Intergenic