ID: 965561229

View in Genome Browser
Species Human (GRCh38)
Location 3:170063924-170063946
Sequence ACACTCTCCTCACCCACGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965561229_965561231 -4 Left 965561229 3:170063924-170063946 CCAGACGTGGGTGAGGAGAGTGT 0: 1
1: 1
2: 2
3: 11
4: 115
Right 965561231 3:170063943-170063965 GTGTGGCTTGCCTTCCCTGCCGG 0: 1
1: 0
2: 2
3: 23
4: 209
965561229_965561232 -3 Left 965561229 3:170063924-170063946 CCAGACGTGGGTGAGGAGAGTGT 0: 1
1: 1
2: 2
3: 11
4: 115
Right 965561232 3:170063944-170063966 TGTGGCTTGCCTTCCCTGCCGGG 0: 1
1: 1
2: 3
3: 28
4: 258
965561229_965561237 16 Left 965561229 3:170063924-170063946 CCAGACGTGGGTGAGGAGAGTGT 0: 1
1: 1
2: 2
3: 11
4: 115
Right 965561237 3:170063963-170063985 CGGGCAGAATTTCCTGAAACTGG 0: 1
1: 0
2: 0
3: 16
4: 228
965561229_965561238 17 Left 965561229 3:170063924-170063946 CCAGACGTGGGTGAGGAGAGTGT 0: 1
1: 1
2: 2
3: 11
4: 115
Right 965561238 3:170063964-170063986 GGGCAGAATTTCCTGAAACTGGG 0: 1
1: 0
2: 4
3: 60
4: 962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965561229 Original CRISPR ACACTCTCCTCACCCACGTC TGG (reversed) Intronic
900232065 1:1564517-1564539 ACCCTCTGCTGAACCACGTCAGG + Intronic
902195678 1:14796268-14796290 ACCCTCTCCCCACCCACACCCGG + Intronic
904298920 1:29541709-29541731 TCACTCTCCTCACCCTTTTCAGG - Intergenic
904818595 1:33224381-33224403 ACACTCTCCTTACTTAGGTCTGG - Intergenic
905390349 1:37632403-37632425 ACACTGGCCTCCCCCACCTCTGG + Intronic
906963606 1:50435037-50435059 ACACCCTCCTCACACTCCTCGGG - Intergenic
911435080 1:97845833-97845855 ACATTCCCCTCATCCACGTGTGG + Intronic
912549639 1:110476812-110476834 AGACTCTCCACACACACGTCAGG - Intergenic
912551458 1:110488035-110488057 ACACTGTACCCACCCACTTCCGG - Intergenic
916608167 1:166363577-166363599 ACACCCTCCTCACCCATTTTGGG + Intergenic
917661751 1:177183494-177183516 TCACTCTCCTCTCCTACGTGGGG - Intronic
919827537 1:201514095-201514117 CCAGTCTCCTCTCCCACATCTGG - Intergenic
922717047 1:227883231-227883253 ACGCTCTCCTCAGCCACCACTGG + Intergenic
1065820813 10:29523578-29523600 ACCCTCCCATCACCCACCTCGGG - Exonic
1067687823 10:48478406-48478428 CCACTCTCCTCTCCCACCCCTGG - Intronic
1069107801 10:64405352-64405374 ACACTCTCCTTACCCTGTTCAGG - Intergenic
1072604039 10:96962935-96962957 ACACTCTTCTCACTCAATTCAGG + Intronic
1075475752 10:122732105-122732127 TCACCCTCCTTACCTACGTCAGG + Intergenic
1078530268 11:12131500-12131522 ACACCCTCATCCCCCAAGTCTGG + Intronic
1079194433 11:18313308-18313330 CCACTCTCTGCACCCACGCCTGG + Intronic
1080750086 11:35143017-35143039 ACACCCTCCCCACCCACTGCAGG - Intronic
1080964809 11:37202192-37202214 TCACTCTTCTCACCCACTTTGGG + Intergenic
1081915170 11:46726092-46726114 ACGCCCTCCTCATCCCCGTCTGG - Exonic
1083580717 11:63823494-63823516 ACACTCTCCCCATCCTCCTCTGG - Intronic
1083638143 11:64131285-64131307 ACCCTCACCCCACCCACGTGTGG + Intronic
1084388134 11:68856898-68856920 ATCCCCTCCTCACCCACCTCCGG - Intergenic
1085350188 11:75793256-75793278 ACACTCCCCTCCCCCAGGGCTGG - Intronic
1085517335 11:77119171-77119193 TCCCTCTCCCCACCCACGGCAGG - Intronic
1090399075 11:126436739-126436761 GCCCTCTCCTCACCTAGGTCAGG - Intronic
1092241575 12:6839275-6839297 ACACTCTCCTCCCCAACCCCAGG + Exonic
1094358891 12:29608732-29608754 ACCCTCTCAGCACCCCCGTCTGG - Intronic
1096452538 12:51756332-51756354 ACACTTTCCTCACCCCACTCGGG + Intronic
1096761347 12:53844430-53844452 TCACTCTCCTTCCCCACATCTGG - Intergenic
1098135847 12:67400972-67400994 ACATCCACCTCAGCCACGTCTGG - Intergenic
1098386070 12:69920099-69920121 CCTCTCACCTCACCCACTTCAGG - Intronic
1099196364 12:79620880-79620902 ACACTCTCTTCACCCTTTTCCGG - Intronic
1100822798 12:98447449-98447471 ACTTTCTGCTCAGCCACGTCGGG - Intergenic
1101682312 12:106981153-106981175 CCACGCTCCTCCCCCACGTGTGG - Intronic
1103469320 12:121167282-121167304 TCACTCTCCCTACCCCCGTCTGG - Intronic
1107915493 13:45145833-45145855 ACACCCTCCTCACCCTGTTCAGG + Intronic
1112898351 13:104329776-104329798 AAGATCTCCTCACACACGTCAGG - Intergenic
1114780895 14:25537015-25537037 ACACCCTCCTCACCCCACTCAGG + Intergenic
1120655992 14:87190468-87190490 ACACTCTCCTTGCCCACAGCAGG + Intergenic
1121101656 14:91253856-91253878 ACGCCCCCCCCACCCACGTCGGG + Exonic
1122156272 14:99752342-99752364 ACACACTCATCACCAACGCCAGG + Intronic
1122365374 14:101192064-101192086 ACACTTTCCTCAGTCAGGTCAGG - Intergenic
1124559159 15:30756023-30756045 TCACTCACCTCACCCACTGCTGG + Intronic
1124672099 15:31649701-31649723 TCACTCACCTCACCCACTGCTGG - Intronic
1129918282 15:79294292-79294314 TCAGGCTCCCCACCCACGTCTGG + Exonic
1131831857 15:96359718-96359740 ACAGTCTCCTCGCCAACTTCGGG - Intergenic
1132202155 15:99962429-99962451 ACACTCTCCACACCCTAGCCAGG - Intergenic
1134555696 16:15162111-15162133 AAACACTCCTCACCCCTGTCAGG - Intergenic
1134916278 16:18073822-18073844 AAACACTCCTCACCCCTGTCAGG - Intergenic
1135241556 16:20811162-20811184 ACACCTTCCTCACCCAACTCAGG + Intronic
1138449197 16:57083082-57083104 ACACTCTCCCCTCCCAGCTCGGG - Exonic
1138659674 16:58509706-58509728 ACACTCCCCTCACCCGCCCCAGG + Intronic
1141444928 16:84051618-84051640 CCACTCTCCTTACCCACATGTGG - Intergenic
1146377682 17:32305567-32305589 ACACACTCCTCACCCTCTGCAGG + Intronic
1148656504 17:49287643-49287665 AAGATGTCCTCACCCACGTCTGG + Intergenic
1152631077 17:81410926-81410948 ACACTCTGCTCCCCCAGGGCGGG + Intronic
1154123418 18:11669874-11669896 TCACCCTCCTCTCCCACATCAGG - Intergenic
1160247314 18:77169247-77169269 CCTCTCTCCTCACGCACGGCTGG - Intergenic
1161041673 19:2113709-2113731 AGCCTGTCCACACCCACGTCAGG - Intronic
1162751540 19:12832933-12832955 ACACTCTCCTCTCCAACTTTGGG + Intronic
1163154780 19:15433701-15433723 GCACTCAGCTCACCCACGTCTGG - Intronic
1164466361 19:28490544-28490566 ACACTCCCCTCATCCAAGCCAGG - Intergenic
1166243574 19:41510276-41510298 TCACTCTCCTCTCCCCCGCCTGG + Intergenic
927857464 2:26536449-26536471 ACACCCTCCCCAACCACTTCAGG - Intronic
929474366 2:42231018-42231040 ACACTCTCTTCACCCCCGTCTGG + Intronic
930011959 2:46944067-46944089 ACTGTCTCCTCACTCACATCCGG + Intronic
931812041 2:65863521-65863543 ACATTCTCCCCACCCAAGTGAGG - Intergenic
933858014 2:86436669-86436691 ACACTCTCCTCCCCCTCCTCAGG + Intergenic
934853164 2:97713808-97713830 ACACTCTCCGCACACACCCCGGG - Intronic
934876975 2:97931672-97931694 ACAATCTCCTCACCCACAAAAGG + Intronic
936022502 2:109005570-109005592 ACACTCTCTTCCCCCTCGTCTGG + Intergenic
937531084 2:122828321-122828343 ACAACCTACTCACCCACATCGGG + Intergenic
938949822 2:136245708-136245730 ACAGTCTCCTCACAGACATCAGG - Intergenic
940881449 2:158950748-158950770 TCACTCTTCTCACCCAGGGCTGG - Intergenic
942854258 2:180526863-180526885 CCCCTCTCCTCACCCATGACAGG + Intergenic
943033265 2:182711070-182711092 ACACTCTCCTCACACTGGTTGGG - Intergenic
946765769 2:223038845-223038867 CCACTCTCCTCTCCCACGGGTGG - Intergenic
1173762880 20:45579327-45579349 ACACTCTGCTCACCCCACTCAGG + Intergenic
1176938092 21:14889759-14889781 TCTCTCTCATCACCCAAGTCTGG + Intergenic
1178404741 21:32315014-32315036 ACACCCTCTTAACCCACGTCCGG - Exonic
1180956919 22:19745358-19745380 ACACTCACATGACCCAAGTCTGG + Intergenic
1184304303 22:43585355-43585377 ATTCTCTCCTCAACCATGTCCGG - Intronic
1184320367 22:43737149-43737171 CCATTCTCTTCAGCCACGTCAGG - Intronic
954088845 3:48268934-48268956 CCACACTCCTCACACACGTGAGG - Exonic
957047367 3:75386314-75386336 TCACTCTTCTCACCCAGGGCCGG - Intergenic
964384867 3:156136834-156136856 AAACTCTCCTCACCTACTTTGGG - Intronic
964761375 3:160137690-160137712 ACCCTCTCCTCCCCCTCTTCTGG + Intergenic
965561229 3:170063924-170063946 ACACTCTCCTCACCCACGTCTGG - Intronic
966214898 3:177491923-177491945 ACACTCCCCTCAGCCACATCTGG + Intergenic
967043601 3:185716661-185716683 ACACTCTCCTTAACCAGATCAGG - Exonic
969690463 4:8701447-8701469 CCTCTCTCCTCACCCAAGTGGGG + Intergenic
969791830 4:9498174-9498196 AGTCTCTCCTCCCCCACGTTGGG + Intergenic
971950691 4:33341051-33341073 ACACTCTCCTTACTTACTTCTGG + Intergenic
972066058 4:34945618-34945640 ACACTCTCCTCACCCACTTCCGG + Intergenic
973171325 4:47147655-47147677 ACACCCTCTTCTCCCATGTCAGG - Intronic
982756782 4:159229419-159229441 ACATTCTCCTCTCCCAAGTTGGG - Intronic
996019553 5:118576591-118576613 ACCCTCTCATCACCCAGATCTGG - Intergenic
997841655 5:137246634-137246656 ACACTGTCCTTACCCCTGTCAGG - Intronic
998251713 5:140557817-140557839 ACAATCTCCACATTCACGTCCGG + Exonic
999083136 5:148863273-148863295 AGCCTCTCCTGACCCAGGTCAGG - Intergenic
999439972 5:151593447-151593469 CCACTCTCCTGACCCACTCCTGG + Intergenic
1000238680 5:159388041-159388063 ACCCTCTCCTCACTTACTTCTGG + Intergenic
1002492111 5:179585991-179586013 ACATTCTCCTGTCCCACGTGGGG - Intronic
1003049907 6:2770435-2770457 ACCCTCTCCTCACTGACGCCCGG - Intronic
1005009390 6:21321647-21321669 ACAGTCTTCTGACCCACTTCAGG - Intergenic
1011057158 6:83217798-83217820 ACCCTCTGCTCCCCCAGGTCAGG - Intronic
1012400294 6:98836464-98836486 ACACTCTCCTCACTCTCTCCAGG - Exonic
1012880466 6:104781858-104781880 ACACCCTCCTCACCCTAGTCAGG + Intronic
1015761382 6:136664899-136664921 TCACTCTTGTCACCCAGGTCTGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019942981 7:4305828-4305850 ACACTCTCCTCATCCACGTGTGG + Intergenic
1021444685 7:20719663-20719685 ACACCCTCCTCACCCTGCTCTGG - Intronic
1023017814 7:35984153-35984175 TCACTCTCCTCTCCCACCACTGG + Intergenic
1034974301 7:155438961-155438983 AAACTCACCTCCCCCACGCCTGG - Intergenic
1037647019 8:20801439-20801461 ACAATCTCCTCACTGAAGTCTGG - Intergenic
1041311087 8:56517141-56517163 ACACTGTCCTCACCGACCTGAGG - Intergenic
1041528209 8:58833000-58833022 CCACTCTCCTCTTCCACGACAGG + Intronic
1047202419 8:122778593-122778615 ACACTGTCCTCAACCACCTTTGG - Intergenic
1047759695 8:127945055-127945077 ACACTCACCCCACCCACTTCAGG - Intergenic
1048834511 8:138505473-138505495 ACAATCGCCTGACCCACATCGGG + Intergenic
1049197770 8:141324968-141324990 TCAGTCTCCTCACCCATGACAGG + Intergenic
1051397299 9:16637722-16637744 GCACTCTCCTCACCCAGGTGAGG - Intronic
1051949492 9:22614162-22614184 ACACTCTCCTCATCCAAGCCAGG - Intergenic
1053452481 9:38204559-38204581 CCACTCTCCCCACCCACCCCTGG + Intergenic
1062006511 9:134240929-134240951 ACCCTCTCCCCACACACATCAGG - Intergenic
1201416052 Y:13750722-13750744 ACACTCTCCTCAGCCGCATCAGG - Intergenic