ID: 965561820

View in Genome Browser
Species Human (GRCh38)
Location 3:170069201-170069223
Sequence CTGAGTCAGGGAAGAGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 1, 2: 4, 3: 26, 4: 324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965561816_965561820 7 Left 965561816 3:170069171-170069193 CCGCAGTTGGAGAGGGAGTCATT 0: 1
1: 0
2: 2
3: 13
4: 160
Right 965561820 3:170069201-170069223 CTGAGTCAGGGAAGAGATCTGGG 0: 1
1: 1
2: 4
3: 26
4: 324
965561812_965561820 20 Left 965561812 3:170069158-170069180 CCTCATTCTTACTCCGCAGTTGG 0: 1
1: 0
2: 1
3: 2
4: 72
Right 965561820 3:170069201-170069223 CTGAGTCAGGGAAGAGATCTGGG 0: 1
1: 1
2: 4
3: 26
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965561820 Original CRISPR CTGAGTCAGGGAAGAGATCT GGG Intronic
900248072 1:1648627-1648649 CTGGTTCACGGAACAGATCTGGG + Intronic
900541652 1:3205956-3205978 CTGAGTCAGGGCAGGGGGCTGGG - Intronic
900667082 1:3822734-3822756 CTGGGGCAGGGAGGAGAGCTTGG + Intronic
901279221 1:8019634-8019656 GTGAGTCAGTGAAGAGCTCAGGG + Intronic
901319849 1:8333165-8333187 CTAAATCAGGGAAGTCATCTAGG - Intronic
901474214 1:9478501-9478523 CTGAGTCAGGGAAGGCTTTTTGG - Intergenic
904680283 1:32224239-32224261 CTCAGTCAGTGAAGAGACCAGGG - Intronic
904932364 1:34099480-34099502 CTGAGCCAAGGCAGAGGTCTGGG - Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905483021 1:38274697-38274719 CTGAGACAGGCAGGAGATCTAGG - Intergenic
909442354 1:75711693-75711715 GTGACTCAGGCAAGAGATGTGGG + Intergenic
911562131 1:99418601-99418623 CTGTGTCAGAGAGAAGATCTGGG - Intergenic
912388896 1:109288012-109288034 CTGGATCAGGGAAAAGACCTGGG - Intergenic
912546607 1:110455824-110455846 GTGAGTCAGGGCAGAGATGGTGG + Intronic
913085775 1:115435212-115435234 CTCAGTCAGGCAGCAGATCTGGG + Intergenic
913382451 1:118226877-118226899 CTGAGGGAGGGAAGGGATCAGGG - Intergenic
915093688 1:153444360-153444382 CTGAGTCAGGCTAGCGATTTGGG - Intergenic
915214538 1:154331055-154331077 CCAGGACAGGGAAGAGATCTGGG - Exonic
915291224 1:154884939-154884961 CTGTGTGAGGATAGAGATCTAGG + Intergenic
915581408 1:156815222-156815244 CTGGATCAGGGAAGAGTTCAAGG + Intronic
917704552 1:177618926-177618948 ATGGGTCAGGGAAGACATCCTGG + Intergenic
918345880 1:183606722-183606744 CCAAGCCAGGGAAGAAATCTGGG - Intergenic
919192321 1:194238150-194238172 TTGAGGCAGTGAAGAGATATTGG + Intergenic
920050117 1:203159370-203159392 CTCAGTCAGAGAAGAGACCTAGG - Intronic
920100950 1:203516760-203516782 CTGGGGCAGGGAATAGGTCTTGG - Intergenic
921163818 1:212491596-212491618 CTGAGTGAGTGGAGAGCTCTAGG + Intergenic
921228946 1:213049640-213049662 CTGAGTCTTGGAAGAGAGATGGG - Intergenic
921372659 1:214440674-214440696 CTGGGTCAATGAAGAGATATGGG + Intronic
921924756 1:220702356-220702378 GTGACTCAGGCAAGAGATATGGG + Intergenic
922322164 1:224498347-224498369 CTGAGTCAGAGAAGAGAACCGGG - Intronic
922371457 1:224914631-224914653 CCGAGTCAGGGAGGACATCCTGG - Intronic
922465388 1:225842932-225842954 CTGAGTCAGGCCACAGAGCTGGG - Intronic
922911092 1:229217807-229217829 CTGTGTCAGTGAAGAGACCCAGG + Intergenic
923285451 1:232490369-232490391 CAGAATCTGGTAAGAGATCTTGG - Intronic
923341689 1:233013100-233013122 CTGAGTCAGGTAAGAGGACAGGG + Intronic
923524314 1:234760420-234760442 CAGAGGCACGGGAGAGATCTGGG - Intergenic
924585398 1:245357072-245357094 CTGAGTCAGGGAACAAGTGTAGG + Intronic
924808213 1:247378586-247378608 CTCTGTCAGGGAAGGGATGTCGG + Intergenic
1063692353 10:8298755-8298777 CTGAGTCAGGAAAGAACTCCCGG + Intergenic
1064025806 10:11848029-11848051 CTGACTCTGGGAAGAGAAATGGG - Intronic
1064395966 10:14982245-14982267 CTGAGGCAGGGAAGCTCTCTTGG - Intronic
1066554593 10:36597392-36597414 CAGAGGCTGGGAAGAGAACTGGG - Intergenic
1069316693 10:67113319-67113341 ATGAGTCAGGGATGAGATAATGG - Intronic
1069493426 10:68881113-68881135 AAGACTCAGGAAAGAGATCTGGG - Intronic
1069610491 10:69769406-69769428 CTGAGTCAGGGAAGGTCTGTGGG + Intergenic
1070288402 10:75099744-75099766 CTGAGGCAGGGAGGAGAGCCTGG + Intronic
1075070960 10:119319589-119319611 ATGAGTCAGGGAAGAGGACATGG - Intronic
1076623617 10:131808548-131808570 CTGAGGCTGGGCATAGATCTCGG - Intergenic
1076657323 10:132033407-132033429 CAGAATCAGGGAGCAGATCTGGG - Intergenic
1076741384 10:132487480-132487502 GTGAGTCAGGCAAGAGACCCGGG + Intergenic
1077670392 11:4151915-4151937 CAAAGTCAGGAAAGAGCTCTGGG + Intergenic
1077671769 11:4164478-4164500 CTCAGTAAGGAAAGACATCTGGG - Intergenic
1078507521 11:11963861-11963883 CTGAGAGAGGGAATTGATCTTGG + Exonic
1078590238 11:12634592-12634614 CTGAGTAAGGGAACAGATTTTGG - Intergenic
1078724516 11:13917804-13917826 CTGATTTAGGGTAAAGATCTTGG + Intergenic
1078858478 11:15225904-15225926 CTGAGGCAGGGGAGAGAGCATGG + Intronic
1082848832 11:57747264-57747286 CTCCCTCAGGAAAGAGATCTAGG - Intronic
1083044273 11:59719041-59719063 CAGAGTCAGGGAAGATATATTGG + Intronic
1083196323 11:61090739-61090761 CTGTGTCACAGTAGAGATCTTGG - Intergenic
1084770814 11:71341833-71341855 ACGAGTCAGGGAGGACATCTCGG + Intergenic
1084799422 11:71532482-71532504 CAAAGACAGGGAAGAGATTTGGG + Intronic
1085984376 11:81768004-81768026 CTGAATTAGGGAAGAGATGAGGG - Intergenic
1087852450 11:103047882-103047904 CTGGGAGAGGGAAGAGACCTTGG + Intergenic
1089195432 11:116691809-116691831 CCTAGGCAGGGAAGAGATCGGGG - Intergenic
1089742155 11:120591905-120591927 CTGAATCAGGGGAGAGATCTTGG + Intronic
1090371591 11:126258449-126258471 CTGATTCAGTTAAGAAATCTGGG - Intronic
1092050090 12:5462904-5462926 GAGAGCCAGGGAAGACATCTTGG + Intronic
1092125627 12:6073287-6073309 GTGTGTCAGGGAACCGATCTGGG - Intronic
1093968141 12:25348689-25348711 CTCAGTCAGGGAAAACATTTTGG - Intergenic
1095245684 12:39918407-39918429 CTGCTTCAGGCAAGAGATCCAGG + Intronic
1096079637 12:48824969-48824991 GTGAGTCAAGGAAGGGACCTGGG + Intronic
1097494672 12:60315766-60315788 CTGTTTTAGGGAAAAGATCTTGG + Intergenic
1097958484 12:65510379-65510401 CTGAGCCAGGGAAGAGCCCTTGG - Intergenic
1097961537 12:65536112-65536134 ATGAGTCAGAGGAGAGATCAAGG - Intergenic
1098605800 12:72388266-72388288 GTAAATCAGGGAAGAGATTTGGG - Intronic
1099332052 12:81301713-81301735 CTGAGACAGAAAAGAGGTCTGGG - Intronic
1100890981 12:99125558-99125580 CTGATTTAGGCAAGAGTTCTGGG + Intronic
1101499442 12:105288750-105288772 CTGAGGCAGGTGAGAGAACTTGG + Intronic
1102724279 12:115045248-115045270 CTGTGTGAGGGAAGGGATTTTGG + Intergenic
1104072699 12:125360110-125360132 GTGACTCAGGCAAGAGATGTGGG - Intronic
1107140233 13:36990910-36990932 GGGAGTCAGGGTAGAGATGTGGG - Intronic
1109625094 13:64963487-64963509 CTATGTCAGAGGAGAGATCTGGG - Intergenic
1111681475 13:91446919-91446941 CTGAGACAGAGAAGAGACCATGG + Intronic
1112191747 13:97184842-97184864 CTGACTCAGGGAAAAGATGGAGG - Intergenic
1113225980 13:108159875-108159897 CTGAGTCAGGCCAGTAATCTAGG + Intergenic
1114069047 14:19094016-19094038 CTGAGTCAGGTAGGAGGACTTGG - Intergenic
1114093213 14:19305989-19306011 CTGAGTCAGGTAGGAGGACTTGG + Intergenic
1116560249 14:46369565-46369587 CTGAGGCAGTGAAGGGATCAGGG + Intergenic
1117622359 14:57600258-57600280 CTTAGTCATGGAAAAGGTCTTGG - Intronic
1118966424 14:70590468-70590490 CAGAGTCAGGGAAGAGAAAAGGG + Intronic
1119699065 14:76739351-76739373 CTGAGTCAAGGAAGAAATTGAGG - Intergenic
1120774840 14:88422216-88422238 CTGTGTCAGCAAAGAGGTCTGGG + Intronic
1120993207 14:90396832-90396854 CTGGGTCGGGGAAGCGTTCTAGG - Intronic
1121338868 14:93093300-93093322 CTGGGGCAGGGCAGAGAGCTGGG - Intronic
1122371441 14:101230850-101230872 CTGGGTCATGGATGAGATTTGGG + Intergenic
1122966256 14:105128254-105128276 GTGACTCAGGCAAGAGATGTGGG - Intergenic
1123144978 14:106120611-106120633 CTGAGGAAGGGAAGAGACATGGG + Intergenic
1124120614 15:26885323-26885345 GTGACTCAGGCAAGAGATGTGGG + Intronic
1125216663 15:37283201-37283223 CTGAGTCAGGACTGAGTTCTTGG - Intergenic
1127280448 15:57486342-57486364 AAGAGTCAGGGAAGAGGTCGTGG + Intronic
1128998835 15:72316637-72316659 ATGGGTCAGCGAAGAGGTCTAGG + Intronic
1129029461 15:72607888-72607910 CTGAGTCAGGGCAGAAATATGGG - Intergenic
1129037399 15:72658932-72658954 CTGAGTCAGGGCAGAAATACAGG - Intronic
1129212488 15:74078293-74078315 CTGAGTCAGGGCAGAAATACAGG + Intronic
1129397911 15:75262786-75262808 CTGAGTCAGGGCAGAAATACAGG - Intronic
1129401522 15:75287067-75287089 CTGAGTCAGGGCAGAAATACAGG - Intronic
1129679383 15:77649614-77649636 CTGGGTCAGGGTGGAGAGCTGGG + Intronic
1129700083 15:77762819-77762841 CTGGGGCAGGGAAGAGGTGTGGG - Intronic
1129729622 15:77922612-77922634 CTGAGTCAGGGCAGAAATACAGG + Intergenic
1129838903 15:78731367-78731389 CTGAGTCAGGGCAGAAATACGGG - Intergenic
1131004268 15:88963812-88963834 ATGGGTCAGGGAAGGGACCTAGG + Intergenic
1131184415 15:90262853-90262875 CTGGGTCAGGGAAGGGATGAGGG + Intronic
1136680081 16:31955606-31955628 CTGAGGAAGGGAAGAGACATGGG - Intergenic
1136889983 16:33962498-33962520 CTGAGGAAGGGAAGAGACATGGG + Intergenic
1139393634 16:66622352-66622374 CTGAGAGGGGGAAGAGATCAAGG - Intronic
1139526447 16:67519586-67519608 GGGTGTCAGGGAAGAGGTCTGGG + Intronic
1139940087 16:70599080-70599102 CTGACTCAGGCAAGAGATGGTGG + Intronic
1141204134 16:81920213-81920235 CTGAGTCATTGGAGAGTTCTGGG + Intronic
1141701931 16:85646608-85646630 CTGTGTCAGGGAAGGGGGCTTGG + Intronic
1203083051 16_KI270728v1_random:1161116-1161138 CTGAGGAAGGGAAGAGACATGGG - Intergenic
1143341153 17:6212206-6212228 CTGAGTCAAGAAAGAAAGCTTGG - Intergenic
1143762507 17:9115647-9115669 ATGAGTCAGGGCACAGACCTCGG - Intronic
1143960519 17:10713939-10713961 CTGATCTAGGAAAGAGATCTGGG - Exonic
1144138137 17:12319105-12319127 TTGAGGAAGGGAAGAGAACTAGG - Intergenic
1145893957 17:28440612-28440634 GTGATTCAGGGAAGAGATGTGGG - Intergenic
1145984148 17:29033101-29033123 GCGAGTCAGGGAAGGGCTCTAGG - Intronic
1146145775 17:30414920-30414942 TGGAGTCTGGGAAGAAATCTAGG + Intronic
1146249949 17:31331198-31331220 CTTTGTCAGGTAAGAGATGTAGG + Intronic
1146254822 17:31385713-31385735 CTGACTCAGGGAAGGCTTCTTGG + Intergenic
1146598390 17:34188888-34188910 CTGAGTCAGCGAAGGGAGATAGG - Intergenic
1148716039 17:49716723-49716745 CTGAGTCGGAGAAGAGTTCTTGG - Intronic
1148743078 17:49903788-49903810 ATGAGTTGGAGAAGAGATCTGGG - Intergenic
1148752428 17:49952967-49952989 CAGAGCCAAGGAAGATATCTGGG - Intergenic
1150841056 17:68605765-68605787 CTGAGTGAAGGCAGAGATATTGG + Intergenic
1151364362 17:73607511-73607533 CTGAGCCAGGGAAGGGGTCTCGG + Intronic
1152964239 18:99725-99747 TTGTTTCTGGGAAGAGATCTTGG - Intergenic
1153243691 18:3053474-3053496 GTGATTCAGGGGAGAGATCATGG - Intergenic
1153651324 18:7242761-7242783 AGGGTTCAGGGAAGAGATCTGGG + Intergenic
1155159490 18:23184134-23184156 CTGAGACAAAGAAGAGAACTTGG - Intronic
1155596299 18:27491954-27491976 CTGAGTCAGGGAGGGGGTCGTGG - Intergenic
1156191770 18:34728667-34728689 TTGAAACAGGGAAGAGAACTTGG - Intronic
1156889550 18:42174980-42175002 CTGTCTCAGAGGAGAGATCTTGG - Intergenic
1157441461 18:47715053-47715075 CTGAGTCTGAGCAGAGGTCTGGG + Intergenic
1157718868 18:49908043-49908065 CTGAGTCAGGGAACAAGCCTGGG + Intronic
1159327624 18:66943784-66943806 CAAATTCAGGGATGAGATCTGGG - Intergenic
1160917914 19:1506560-1506582 CTAAGTCAGGGTAGAGGTCGGGG + Intronic
1163775027 19:19212657-19212679 CTGACTCAGGGAGGAGGTCCTGG + Intronic
1164558453 19:29271098-29271120 CTGAGTCAGGGAACAGAGGGTGG - Intergenic
1165479092 19:36051390-36051412 GGGAGTCACGGAAGGGATCTGGG + Intronic
1165786795 19:38466460-38466482 CTGAGTCAGGTCAGAGATCAGGG - Intronic
1165920225 19:39292827-39292849 CTGAGTCAGGGAAGTGCTCTAGG - Intergenic
1166998603 19:46731813-46731835 ATGACGCAGAGAAGAGATCTGGG - Intronic
1166999401 19:46737039-46737061 CCGAGTAAGGGAAGAGAGCAGGG - Intronic
1167096896 19:47379497-47379519 CTGAGTCAGGGAAGGGGGCTGGG - Intronic
1167247572 19:48382940-48382962 CTGGGGAAGGGAAAAGATCTTGG + Exonic
1168495462 19:56844434-56844456 CTGTGTCTGGGATGAGATCCTGG - Intergenic
924968500 2:100891-100913 CTGGGTCAGGCAAGGGTTCTGGG + Intergenic
925081688 2:1074060-1074082 CTGAGTCTGGGAACCTATCTGGG - Intronic
926137133 2:10344313-10344335 CTCAGGCAGGGATGGGATCTGGG - Intronic
927292569 2:21419679-21419701 CTGAGTTAGGGAAAAGTTATGGG - Intergenic
927441586 2:23122302-23122324 GGGAGTCAGGGAAGACTTCTAGG - Intergenic
928285843 2:29989436-29989458 CAGAATCATGGAAGGGATCTTGG - Intergenic
929010460 2:37437934-37437956 CTGAGTCCGGGAAGAAAAATAGG + Intergenic
929125949 2:38522982-38523004 CTGGGTACGGGAAGAGAACTGGG - Intergenic
929291169 2:40193593-40193615 GTGAGTCAAGAAAGAGAGCTTGG + Intronic
929605649 2:43232490-43232512 CTTAGCCAGGGGAGAGAACTCGG - Intronic
930256656 2:49101198-49101220 ATGAACCAGGGAAGAGATGTTGG + Intronic
930694514 2:54397560-54397582 CTGAATCAGGGAAGGCATCCTGG - Intergenic
931665640 2:64608243-64608265 CTGGTTCAGGGAGGAGAGCTGGG - Intergenic
932353069 2:71047324-71047346 CTGAGACAGGGAAGCTCTCTTGG + Intergenic
932387997 2:71356165-71356187 CTAAGTCAGAGAAGAGCTTTAGG - Intronic
932436431 2:71704883-71704905 CTGAGTCAGGGACCAGAACTGGG + Intergenic
934854282 2:97719258-97719280 CTCAGTCGGGCGAGAGATCTGGG + Intronic
935088386 2:99870348-99870370 CAGAGTCAGGGTAGAAATCTAGG - Intronic
936025447 2:109027937-109027959 CTGAGGCAGGGAAGAGCTCAAGG + Intergenic
936061062 2:109296054-109296076 CTGGGGCAGGGAAGGGATCCTGG - Intronic
936245824 2:110826528-110826550 CTGGGTCAGGCAAGAGGTCTGGG - Intronic
937387362 2:121447954-121447976 ATGAGACAGTGAAGACATCTTGG - Intronic
937665539 2:124483093-124483115 CTGGGTCAGGGAAGAGGTAAAGG - Intronic
939257371 2:139760947-139760969 CTGAGTCAAGGAAGAGAACTTGG + Intergenic
940624206 2:156151524-156151546 CTGAGTCATGGGAGAAATCATGG - Intergenic
940917441 2:159272354-159272376 GTGACTCAGGGAAGAGACATGGG + Intronic
942513049 2:176723078-176723100 CAGAGTCAGTCAAGAGGTCTGGG + Intergenic
942727126 2:179022475-179022497 TTGGGGCAGGGAAGAGAGCTAGG - Intronic
944253827 2:197604291-197604313 CTGAGTATGAGCAGAGATCTTGG - Intronic
945935631 2:215900298-215900320 CTGAGGCAAGGCAGAGAACTGGG + Intergenic
945972717 2:216245981-216246003 CAGGGGCAGGGAAGAGACCTTGG - Intergenic
947665704 2:231904237-231904259 CTGGGGCAAGGAAGAGCTCTGGG - Intergenic
948088009 2:235266873-235266895 CTGAGACAGGGTTGAGACCTGGG + Intergenic
948121302 2:235532747-235532769 CTGAGGCAGGTAGGAGCTCTTGG - Intronic
1169132335 20:3172807-3172829 CTGAGGGAGGAAAGGGATCTGGG + Intronic
1169161086 20:3379025-3379047 ATGACTCAGGGAAGGGCTCTTGG - Intronic
1169278069 20:4246878-4246900 CTGAGTCAGGAAAGAGACAATGG - Intronic
1169297186 20:4410371-4410393 CTGAGTGTGGGAAGAGGTGTAGG + Intergenic
1170134810 20:13061179-13061201 GTGACTCAGGGAAGAGACATGGG + Intronic
1170301580 20:14890181-14890203 ATAAGTCAGGAGAGAGATCTGGG + Intronic
1170993531 20:21328642-21328664 GCGAGTCAGGGAAGAAATATTGG + Exonic
1171326400 20:24297374-24297396 GTGAATCAGGGAAGAAACCTGGG + Intergenic
1172024915 20:31941899-31941921 CTGAGTTAGGGAAGCGTTCAGGG + Intronic
1172185798 20:33030301-33030323 CTGAGCCAGGCAACAGAGCTGGG - Intergenic
1172623041 20:36332054-36332076 CTGAGTCAAGCCAGAGACCTTGG + Intronic
1172907541 20:38380053-38380075 ATGAGGCTGGGAAGAGCTCTTGG + Intergenic
1173144787 20:40515219-40515241 ATGAGGCAGGGAAGAGAACTTGG - Intergenic
1173604783 20:44324275-44324297 TGGGGTCAGGGAAGAGTTCTTGG + Intergenic
1175201282 20:57279598-57279620 CTGAGTCAGGGTGGAGGTCAGGG + Intergenic
1175907867 20:62390556-62390578 CAGCGTCAGGGTGGAGATCTGGG - Exonic
1178846198 21:36176149-36176171 CTGAGTCAGGAAAGCGTTCCAGG + Intronic
1180261759 21:46675106-46675128 CTGGGTCAGGCAAGGGTTCTGGG - Intergenic
1180487520 22:15816576-15816598 CTGAGTCAGGTAGGAGGACTTGG - Intergenic
1180590417 22:16932513-16932535 GTGAGGCAGGGAAGAGATGATGG + Intergenic
1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG + Intergenic
1181390481 22:22576884-22576906 CAGAATCAAGGAAGAGACCTCGG - Intergenic
1181913909 22:26263780-26263802 CTGAGAGAAGGAAGAGATCAAGG - Intronic
1183086959 22:35492273-35492295 CTGAGGCAGGGAACACACCTGGG - Intergenic
1183430317 22:37761875-37761897 CTGAGGCAGAGAAGGGAGCTGGG + Intronic
1183671968 22:39278284-39278306 CCGTGTCCGGGAAGAGCTCTGGG - Intergenic
1184594654 22:45506518-45506540 CAGAGTCAGGGAAGACTTCCCGG + Intronic
1184996910 22:48213965-48213987 GTGACTCAGGCAAGAGATGTGGG - Intergenic
1185020423 22:48371409-48371431 CTGAGTCTGGGGAGAGATACAGG - Intergenic
949421536 3:3871644-3871666 CTGGGTCAGGGGAAAGAGCTGGG - Intronic
950271314 3:11617487-11617509 CTGAGTCAGGGAACAGGGCAGGG + Intronic
952122804 3:30264620-30264642 CTGTGTCAGAGGAAAGATCTGGG - Intergenic
952142495 3:30495563-30495585 CTGAGTCAGGAAAGAGACACAGG + Intergenic
954871962 3:53774218-53774240 CTGGGTCAGGGAAGGCCTCTAGG - Intronic
956167211 3:66405812-66405834 CTGAGCCAGGGAGGACATCTGGG + Intronic
960368914 3:116810138-116810160 GTTAGTCAGGGAAGAGATTATGG - Intronic
960493956 3:118353291-118353313 CTGAGTCTGGGAGGTGATCTCGG + Intergenic
961612496 3:128152420-128152442 GTGGGTCAGGGAAGACATCTAGG - Intronic
961949586 3:130735241-130735263 CTGAGTCATGGAAAAGATTGTGG - Intronic
962400607 3:135055999-135056021 GGAAGTCAGGGAAGAGTTCTGGG - Intronic
964415387 3:156442798-156442820 CTGGATCAGGGCAGAGAGCTGGG - Intronic
964614909 3:158652865-158652887 CAGGGACAGGGAAGAGAACTGGG - Intronic
964663678 3:159149869-159149891 ATGAGTCAGGGGAGAGATGGAGG - Intronic
965561820 3:170069201-170069223 CTGAGTCAGGGAAGAGATCTGGG + Intronic
966085124 3:176061648-176061670 CTGAGTCAGTGAAGGGAGATAGG - Intergenic
966183990 3:177212137-177212159 CTGAGTGAGGGAAATGAACTGGG - Intergenic
966389757 3:179439518-179439540 CTGCTTTAGGGTAGAGATCTCGG - Intronic
967646277 3:191928116-191928138 GAGAGTCAGGGAAGAGAGATAGG + Intergenic
968501285 4:951434-951456 CTGTGTCTGGGAGGAGATATAGG - Intronic
968981009 4:3849322-3849344 TTGAGTCAGGGAAGAGCACATGG - Intergenic
969662319 4:8537544-8537566 CTTAGTCAGGCATGGGATCTGGG + Intergenic
969667425 4:8568282-8568304 CTGGATCAGGGAAAAGATCTGGG + Intronic
969793377 4:9507516-9507538 CCGAGACAGGGAAGCGCTCTTGG + Intergenic
969890896 4:10259091-10259113 TTGAGCCAGTGAAGAGTTCTAGG + Intergenic
971948856 4:33316764-33316786 CTGTGACAGGCAAGGGATCTGGG - Intergenic
972602209 4:40582611-40582633 GTGAGGCAGGGAACAGATCCTGG - Intronic
974243059 4:59276925-59276947 CTGAGTCAAGGAAGAAATTAAGG + Intergenic
974270516 4:59645807-59645829 CTGAGTGAGAAAAGAAATCTAGG - Intergenic
975258364 4:72267117-72267139 CTGAGTCAGTGAATGGATATTGG + Intergenic
976571825 4:86620751-86620773 CTGATTTAGGGAAGAGCACTTGG - Intronic
976965942 4:91041218-91041240 CTAAGTCAGGGATGAGAACCTGG - Intronic
978637082 4:110822426-110822448 TTTAGTCAGGGAAGTGACCTGGG + Intergenic
979073743 4:116243857-116243879 CTGAGACAGGGGAGGCATCTTGG - Intergenic
979853907 4:125608550-125608572 CTGATTCACAGAAGAGATGTTGG - Intergenic
980099714 4:128529479-128529501 GTGAGTCAGGGAAGACTTCCTGG + Intergenic
980644982 4:135632596-135632618 CTATGTCAGAGAAAAGATCTGGG + Intergenic
981530231 4:145745373-145745395 CAGAGTCTGGGAAGGGTTCTAGG - Intronic
982077575 4:151753088-151753110 CTGGGGCAGGGAAAAGAACTGGG + Intronic
982560412 4:156922760-156922782 ATGAGCCAGTGAAGAGATCGAGG + Intronic
983861338 4:172711096-172711118 ATAAGTCAGGGAAGAGAATTGGG + Intronic
984419148 4:179497297-179497319 CAGGGTCAGGGGAGAGATTTTGG - Intergenic
985865537 5:2511298-2511320 CTGACTCAGGCTAAAGATCTGGG + Intergenic
989564444 5:42887910-42887932 CTGATTCAGGCAGGAGATATGGG - Intergenic
995030168 5:107471379-107471401 CTCAGAAAGGGAAGAGATCTTGG - Intronic
998177339 5:139909993-139910015 CTCAGTCAGTGCAGAGAACTAGG + Intronic
1000804117 5:165767057-165767079 CTGAGGATGGGAAGAGAACTGGG + Intergenic
1001443874 5:171767969-171767991 TTGTTTCAGGGAAGAGGTCTAGG + Intergenic
1001795384 5:174498081-174498103 CTGAGACAGGGAAGAAAAATAGG - Intergenic
1001841734 5:174882046-174882068 GTGACCCAGGGAAGAGATATTGG + Intergenic
1003602045 6:7526604-7526626 CTGAGTTAGAGAAGAGACATTGG + Intergenic
1006365799 6:33614405-33614427 CTGAGTCAGGGAGAAGGTCTGGG + Intergenic
1008210586 6:48719534-48719556 CTGAGGCTGGGAAGAGAAGTGGG - Intergenic
1010584751 6:77643927-77643949 CTGTGTCAAGGAAATGATCTGGG - Intergenic
1011686327 6:89826879-89826901 GTGACTCAGGCAAGAGATGTTGG + Intergenic
1016910033 6:149189918-149189940 CTGTGTCAGAGAAAAGATCTGGG + Intergenic
1017046869 6:150355268-150355290 GTGAGTCAGGGAAGAGATGTGGG - Intergenic
1017578311 6:155831259-155831281 CTGAGGCAGTGGCGAGATCTTGG - Intergenic
1019710933 7:2517986-2518008 GTGATTCAGGGAAGAGATGATGG + Intronic
1021609209 7:22441628-22441650 GTGACTCAGGCAAGAGATGTGGG - Intronic
1021871962 7:25015836-25015858 CTGAGTAGGGGGAGATATCTGGG + Intergenic
1022283837 7:28936302-28936324 CTGAGACGGGCAAGAGATTTTGG - Intergenic
1022440153 7:30426476-30426498 CTGATGCAGGGAAGAGATGATGG - Intronic
1022725404 7:32976756-32976778 CTGAGTGATGGAAATGATCTGGG - Intronic
1023594554 7:41815255-41815277 CCGAGTCAGGAAGGAGAGCTGGG + Intergenic
1024002074 7:45196642-45196664 CTGATTCTGGGAGGACATCTCGG + Intergenic
1024921599 7:54562655-54562677 CTGAGCCGGGGAAGGGCTCTGGG + Intronic
1025048209 7:55711060-55711082 CTGAGTGATGGAAATGATCTGGG + Intergenic
1026842822 7:73679952-73679974 CTGAGTCAGGGGAGAGGCTTAGG + Intergenic
1028648063 7:93120217-93120239 CTGTGTCAGGGGGAAGATCTGGG - Intergenic
1029078598 7:97954930-97954952 CTGAGACAGGGAAGCTCTCTTGG - Intergenic
1030493558 7:110268695-110268717 CTTAGACAAGGAAGAGATATTGG - Intergenic
1031655375 7:124348953-124348975 CTATGTCAGAGAAAAGATCTGGG + Intergenic
1032013935 7:128364267-128364289 TGGAGTTAGGGAAGAGGTCTAGG - Intergenic
1034106729 7:148496773-148496795 CTGAGTCAGGGAAGAAATCTGGG - Intergenic
1034210095 7:149355936-149355958 CTGAGTAAGTGCAGGGATCTGGG + Intergenic
1034335809 7:150323012-150323034 CCGAGTCCGGGAGGAAATCTAGG + Intronic
1035487316 7:159236200-159236222 AGGAGTCAGGGAAGACTTCTTGG + Intergenic
1036239412 8:7069549-7069571 CTGAGACAGGGAAGCTCTCTTGG + Intergenic
1036753359 8:11456855-11456877 CTGAGTTAGGGAAGTGAGTTGGG + Intronic
1036817040 8:11910065-11910087 CTGAGACAGGGAAGCTCTCTTGG - Intergenic
1036906407 8:12711649-12711671 CTGAGACAGGGAAGCTCTCTTGG - Intergenic
1037279384 8:17219843-17219865 CTGAGTCAGGAAGGACATTTAGG - Intronic
1037677985 8:21068324-21068346 CTGATTCAGGCAAGAGGGCTGGG - Intergenic
1039220055 8:35320457-35320479 CTGGATCAGGGAAAAGACCTGGG + Intronic
1039457133 8:37715016-37715038 GTGGGTGAGGGAAGAGACCTGGG + Intergenic
1040011385 8:42663927-42663949 CTGAGACAGGGAAGAGACGAGGG + Intergenic
1040444846 8:47483036-47483058 CAGAGTCAGGGGACAGGTCTGGG + Intronic
1041120273 8:54579554-54579576 CTGTGTCAGGGAGAAGTTCTGGG + Intergenic
1044009057 8:86968943-86968965 CTGTTTGAGGGTAGAGATCTTGG + Intronic
1044335074 8:90973175-90973197 CTGAGTCAGGGTATCGAACTTGG + Intronic
1044582458 8:93835737-93835759 GTGACTCAGGCAAGAGATGTGGG - Intergenic
1044890471 8:96829699-96829721 CTGACTAAAGGAAGAAATCTAGG - Intronic
1045522491 8:102915357-102915379 ATGGGTCAGGAAAGAGAACTTGG - Intronic
1045580115 8:103469469-103469491 CTTATTGAGGGAAGAGATGTCGG + Intergenic
1047099487 8:121660380-121660402 CTGAGAAAGAGAAGAGATATAGG + Intergenic
1049010607 8:139884596-139884618 CTGAGCCGGGAAAGACATCTGGG - Intronic
1051146811 9:14035535-14035557 CTGAGTCTAGGTTGAGATCTGGG - Intergenic
1051730859 9:20141255-20141277 CTGAGACATGGAAGAGATAGAGG - Intergenic
1052825168 9:33168791-33168813 GGAGGTCAGGGAAGAGATCTGGG - Intergenic
1053152958 9:35754521-35754543 CCAGGTCAGGGAAGAGATCTGGG - Exonic
1054703401 9:68436888-68436910 ATGAGTCAGGAAATACATCTGGG - Intronic
1056448907 9:86695681-86695703 CTGAGTAAAGGAAGAGAGATAGG + Intergenic
1056712024 9:88998991-88999013 ATGAGTGATGGGAGAGATCTGGG + Exonic
1057707838 9:97410187-97410209 CTTAGTCAGGGACCAGATCTAGG + Intergenic
1057785637 9:98085506-98085528 GTGGGTCTGGGAAGAGGTCTTGG + Exonic
1058058432 9:100472796-100472818 CTGAGTCACGGAAGAGGTAAAGG - Intronic
1058704802 9:107629376-107629398 TTAAGTCATGGAAGAGATTTGGG - Intergenic
1059365088 9:113780761-113780783 TGGATTCAGGGAAGAGGTCTGGG - Intergenic
1060721850 9:125984761-125984783 CTGAGGGAGGGAAGTGCTCTGGG - Intergenic
1061064104 9:128266876-128266898 CTGAGTCAGGGCAGAAATACAGG + Intronic
1061690158 9:132321118-132321140 CTGAGTGTGGGAAGAGGGCTGGG - Intronic
1185833561 X:3323596-3323618 CAGAGTCAGAGAAGACATCGTGG - Exonic
1186322963 X:8450507-8450529 CTGAGTCCGAGAAGAGAACATGG + Intergenic
1187052394 X:15707785-15707807 ATGTGTCAGGGGAGAGACCTGGG + Intronic
1187872898 X:23779009-23779031 CTGAGTAGGGGAAGAGTACTGGG - Intergenic
1188301318 X:28507559-28507581 GAGAGTCAGCGAAGAGATATGGG + Intergenic
1189014291 X:37079249-37079271 GGATGTCAGGGAAGAGATCTTGG - Intergenic
1189039250 X:37525032-37525054 CTGAGTGGAGGAAGAAATCTGGG - Intronic
1189137859 X:38568061-38568083 CTGAGTGAAGAAACAGATCTTGG - Intronic
1192281513 X:69692106-69692128 CAGAGAAAGGGAAAAGATCTAGG - Intronic
1192392598 X:70746279-70746301 CTGTGTCATGGAAGTGTTCTGGG + Intronic
1193938864 X:87656221-87656243 CCTAGTCCAGGAAGAGATCTAGG - Intronic
1194967449 X:100304433-100304455 CTGTGTCAGAGAGAAGATCTAGG - Intronic
1195861389 X:109387138-109387160 GTGATCCAGGCAAGAGATCTTGG + Intronic
1197521070 X:127496543-127496565 CTGAGTCAAGGAAGATATTAAGG + Intergenic
1198641861 X:138764891-138764913 CAGAGGCAGGAAAGAAATCTGGG + Intronic
1199061520 X:143361211-143361233 CAGAGGCAGGGAAGAGTTGTAGG - Intergenic
1199430543 X:147754460-147754482 GAGAGTCAGGGAAGTGTTCTTGG - Intergenic
1199725087 X:150572160-150572182 CAGAGTTAAGGAAGAGAACTGGG - Intronic
1199987073 X:152960175-152960197 CTGGGTCAGGGGAGGGATATAGG + Intronic
1200271020 X:154683531-154683553 TGGAGTGAGGGAAGGGATCTTGG + Intronic
1200377772 X:155802390-155802412 CTGAGTTAAGGAAGACACCTTGG - Intergenic
1201585972 Y:15561607-15561629 CAGGCTCAGGGAGGAGATCTGGG - Intergenic
1201938511 Y:19433564-19433586 CTGAGCCTGGGAAGAGTCCTGGG - Intergenic
1202366815 Y:24171274-24171296 CTGAGGCAGGGCAGAAATATGGG - Intergenic
1202503967 Y:25498849-25498871 CTGAGGCAGGGCAGAAATATGGG + Intergenic