ID: 965562620

View in Genome Browser
Species Human (GRCh38)
Location 3:170076111-170076133
Sequence TTGTATCTAGGGAGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965562620 Original CRISPR TTGTATCTAGGGAGGGAAAC TGG Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
901225461 1:7610689-7610711 TTGTTTCTAGGGAGGGGCAGAGG - Intronic
902811917 1:18892775-18892797 TTTTAGGGAGGGAGGGAAACTGG - Intronic
903390001 1:22956930-22956952 TTGCCTCTAGGGAGGGGAAATGG - Intronic
904357836 1:29952672-29952694 TTGTAACTATTGGGGGAAACTGG + Intergenic
904889917 1:33772073-33772095 TTGGATTTAGGGAGGGAAAAGGG - Intronic
905651583 1:39660587-39660609 CTGTTTCCAGTGAGGGAAACAGG + Intronic
905881251 1:41465644-41465666 TTGCATCTAGGAAAAGAAACAGG + Intergenic
906707809 1:47907537-47907559 CTGTAAATAGGGAGGGGAACTGG + Intronic
908634094 1:66143197-66143219 TTGTTTCTAGTGAGAGAAACAGG + Intronic
908962870 1:69722046-69722068 TTCTCTCTAGAGAGGGAAATTGG - Intronic
910159874 1:84261205-84261227 TTGTAACAAAGGAGGGAAAATGG + Intergenic
910515929 1:88060193-88060215 TGGTATCTAGGAAGAGAAAGAGG - Intergenic
910807240 1:91201054-91201076 TTTTTTCTAAGGAGGGAAAGGGG - Intergenic
913343409 1:117782868-117782890 TTGTATCCATGGAGGATAACTGG - Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915369663 1:155337929-155337951 TTGTATCTTGGTAGTGAAACTGG - Intronic
915610410 1:156987544-156987566 TTGTCTCTGAGGAGGGAAACTGG + Intronic
915638283 1:157201681-157201703 TTGCCTCTGGGGAGAGAAACTGG - Intergenic
917635098 1:176928263-176928285 TTGCCTCTAGGGAGTGGAACAGG + Intronic
918053579 1:180997889-180997911 TTATTTCTAGGGAGTGAAATTGG + Intronic
918924707 1:190767237-190767259 TTGTATTTAGGAAGAGAAAGTGG + Intergenic
919218968 1:194600707-194600729 TTATCTCTGGGGAGGGAAACTGG - Intergenic
919458617 1:197849230-197849252 TTACCTCTAGGGAGGGAAAGAGG + Intergenic
920310045 1:205043491-205043513 TTGTAACTTGGGAGGGAACAGGG + Intronic
920874934 1:209826101-209826123 CTGCCTCTGGGGAGGGAAACTGG + Intergenic
921221846 1:212979108-212979130 TGGAATCTAGAGAGGGAAGCTGG - Intronic
922272766 1:224049441-224049463 TTGCTTCTAGGGAAGGAAGCTGG + Intergenic
923489895 1:234475323-234475345 TTGTATCAAGGCAGGGACAAGGG - Intronic
923705107 1:236337605-236337627 TTGTAGTAAGGGAGAGAAACAGG + Intergenic
923946036 1:238888671-238888693 TGGTACCAAGGGAGGGAAAATGG + Intergenic
924502169 1:244647967-244647989 CTCTATCTAGGGAGGGATATTGG + Intergenic
1064569582 10:16678769-16678791 TTATCTCTAGGGAAAGAAACTGG - Intronic
1064882701 10:20074413-20074435 TTTTTTTTTGGGAGGGAAACTGG - Intronic
1065233282 10:23621090-23621112 GTGCATGTAGGGAGGGAAAAAGG + Intergenic
1066214508 10:33273450-33273472 TAGTCTCTAGGGAGGGATGCTGG - Intronic
1069838135 10:71322149-71322171 CTGTCTCTAAGGAGGGAAACTGG - Intronic
1072225281 10:93363204-93363226 TTCTATTTAGGCAGGGAAAAAGG + Intronic
1072289421 10:93949023-93949045 TTGTATCAAGGGAAAGAAGCAGG - Intronic
1078233122 11:9460664-9460686 TTGTAGCGAGGGAGGGAGGCTGG - Intronic
1078535357 11:12169093-12169115 TTGCCTCTAGGAAGGAAAACTGG - Intronic
1079264695 11:18920027-18920049 ATGTTTCTCGGGAGGGAAAAGGG + Intergenic
1079288843 11:19167463-19167485 ATATTTCTAGGGAGGGAAACTGG - Intronic
1079451800 11:20604627-20604649 TCTTATCTAGAGAGGGACACAGG + Intronic
1080687305 11:34525909-34525931 ATGTTCCCAGGGAGGGAAACTGG - Intergenic
1083246989 11:61436345-61436367 TTCTCCCTAGGGAGGGAAACAGG - Intronic
1085203614 11:74717145-74717167 ATGGATTTAGGGGGGGAAACAGG + Intronic
1086063977 11:82727989-82728011 AAATATCTAGGGAGGGATACAGG + Intergenic
1087090968 11:94272651-94272673 ATGTATCTATGGAGATAAACAGG + Intergenic
1087093893 11:94302385-94302407 TTCTGTCTAGGGAGGTAAATAGG - Intergenic
1090475897 11:127019768-127019790 TTGTATCTAAGGTGTAAAACAGG - Intergenic
1091094912 11:132811203-132811225 TCGTCTCTAGGTTGGGAAACAGG + Intronic
1093752430 12:22816133-22816155 TTATATCTAGGGAAGAAATCAGG - Intergenic
1093943554 12:25082176-25082198 TTGTGTCTAGGGAGATAAACTGG + Intronic
1097089845 12:56496197-56496219 TTGCCTCCAGGGAGGGAAGCTGG - Intergenic
1097909894 12:64958569-64958591 TTGCCTCTGGGGAGGGAAAATGG - Intergenic
1097910015 12:64959470-64959492 TTGCCTCTGGGGAGGGAAAATGG - Intergenic
1098986476 12:77017847-77017869 TTGTAGGAAGGGAGGGAAAGTGG + Intergenic
1100029402 12:90167769-90167791 TTATATCTAGCCAGGGAGACTGG + Intergenic
1101014852 12:100489730-100489752 TTGTATTTAGGTAAGGAAAATGG + Intronic
1102361727 12:112293736-112293758 TTGCCTCTGAGGAGGGAAACTGG + Intronic
1103628202 12:122236941-122236963 TCACATCTGGGGAGGGAAACTGG + Intronic
1106393797 13:29360823-29360845 TTGTACCTAAAGAGGAAAACAGG + Intronic
1107095883 13:36534520-36534542 TTGGTTCTCGGGAGTGAAACTGG + Intergenic
1111232279 13:85359884-85359906 TTGCATCTAGTTAGGGACACTGG + Intergenic
1111787827 13:92813480-92813502 TTGGAACTATGGAGGGAAAAGGG - Intronic
1113504614 13:110806696-110806718 TGGTATCTAGGTAGGGTATCTGG + Intergenic
1116126580 14:40796328-40796350 TTCTATCTAGGAAGAGAAATTGG + Intergenic
1116153915 14:41178508-41178530 TTCTCTCTGGGGAGGAAAACAGG + Intergenic
1117021871 14:51579206-51579228 TGGAATCCAGGGAGGGAAATTGG - Intronic
1117228883 14:53694734-53694756 TTGTCTCCAGGGAAGGGAACTGG - Intergenic
1120914503 14:89698920-89698942 TTGTATATAAGGAATGAAACTGG + Intergenic
1121916237 14:97838986-97839008 TTGTTTTTCGGGAGGGAAAGAGG - Intergenic
1122011957 14:98757796-98757818 TTGTATCTAGGGATCCAAAAAGG - Intergenic
1122227348 14:100287408-100287430 TTGTCTCTGGGGTGGGAAAGGGG - Intergenic
1122336324 14:100989879-100989901 TTTTATCTAGTGAGGGATATTGG + Intergenic
1125487995 15:40125509-40125531 TAGTATCCAGGGAGGGAGAGGGG - Intergenic
1125972716 15:43924957-43924979 TTGCTTCTAGGGAGAGGAACTGG - Intronic
1126078604 15:44937241-44937263 TTGTCTCTTGGGAGGGGAGCTGG - Intergenic
1126079244 15:44943084-44943106 TTGTCTCTTGGGAGGGGAGCTGG + Intergenic
1128157900 15:65403357-65403379 TTGTCTCTGGGGAGGGGACCTGG + Intronic
1129739265 15:77982089-77982111 TTGTCTCTAGACAGGGACACTGG + Intergenic
1129833772 15:78688616-78688638 TTGTCTCTTGGGAGGGGAGCTGG - Intronic
1129924325 15:79349394-79349416 TTGCATCTGGGAAGAGAAACTGG + Intronic
1131383933 15:91986994-91987016 GTGTATCCAGGCAGGGACACAGG + Intronic
1131537539 15:93250026-93250048 TTGAATCTGGGGAGGGGAAAGGG + Intergenic
1132020191 15:98354323-98354345 TGGTATCTAGGGTGTGAGACTGG - Intergenic
1134105116 16:11479825-11479847 TTGGATCTCGGGACGGAAAGAGG - Intronic
1135630948 16:24035308-24035330 CTGTCTCAAAGGAGGGAAACAGG + Intronic
1138203582 16:55107865-55107887 TTGTGTCAAGGGAGGGACATGGG - Intergenic
1138243688 16:55449641-55449663 TTGTCTCTAAGGGGTGAAACTGG - Intronic
1139733080 16:68964374-68964396 TTATTTCTGGGGAGGGAAACTGG - Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1142877372 17:2860013-2860035 TTGTTTCTAGGGTGTGAACCTGG + Intronic
1150110626 17:62496065-62496087 TTGTCTCTAGGAAGGAAACCAGG - Intronic
1152508186 17:80766693-80766715 TTGTCACTAGGGAAAGAAACAGG + Intronic
1153190578 18:2533389-2533411 TTGGCTCTAGGGAGGGAAGAAGG + Intergenic
1155490424 18:26395972-26395994 GTGAATCTAGGGAGGGGAGCAGG - Intergenic
1155545464 18:26910053-26910075 TAGTATCTAGGGACAGAAACTGG - Exonic
1158453515 18:57587055-57587077 TTGTGACTAGGCAGGCAAACTGG - Intergenic
1159482034 18:69001873-69001895 TTGTATCAAGGCAGGGAAACTGG - Intronic
1161186431 19:2924449-2924471 TTGTATGATGGGAGGGAAGCTGG - Intergenic
1165028289 19:32978034-32978056 CTGCATCTAGTGAGGGAAGCAGG + Exonic
1165036943 19:33040605-33040627 TTTTCTCAAGGGAGGGAAGCTGG + Intronic
1168149607 19:54438042-54438064 ATGTATCTGGGTAGGGAAAATGG + Intergenic
927657076 2:24958217-24958239 TTGCCTCTAGGGAGTGGAACTGG - Intronic
929321188 2:40545343-40545365 ATGGATCTAGGGAGGCAAATGGG - Intronic
929412026 2:41707653-41707675 TTGCAACAAGGGAGGTAAACAGG + Intergenic
929728309 2:44457150-44457172 TTATTTCCAGAGAGGGAAACTGG - Intronic
930196643 2:48517224-48517246 CTGCATCTAGTGAGAGAAACAGG - Intergenic
930241550 2:48940818-48940840 TTGTCTCTAGGGAGCAACACAGG + Intergenic
930902802 2:56528131-56528153 TTGTATTTATGGTGGGACACAGG + Intergenic
932222121 2:70007748-70007770 TTATATCTAGGGAGTGGGACTGG + Intergenic
932368885 2:71171478-71171500 TTGTCTCTTGGGAGGGGAGCTGG - Intergenic
937953051 2:127402913-127402935 TTATAGCTATGGAGAGAAACAGG - Intergenic
938057467 2:128227195-128227217 GTTTATCATGGGAGGGAAACTGG + Intergenic
938687420 2:133753480-133753502 TTACATCTGGGGAGGGGAACTGG + Intergenic
939232817 2:139452238-139452260 TTGTATATAGTGAGGGATATGGG + Intergenic
939281571 2:140072305-140072327 TTGTATTTAAGAAGGGAAACGGG - Intergenic
939873998 2:147555836-147555858 CTCTATCTAGGGAGGGCAAGTGG - Intergenic
941182320 2:162274484-162274506 CTGCATCTAGGGAGGGGAGCTGG + Intronic
941485508 2:166075290-166075312 TTGCCTCTAGGAAGGGGAACTGG - Intronic
942586025 2:177479038-177479060 TTCTCTCTGGGGAGAGAAACAGG - Intronic
945206212 2:207335022-207335044 TTGTTTATAGGAAAGGAAACAGG + Intergenic
945583003 2:211620707-211620729 TGTTATCTAGGGTGGAAAACAGG + Intronic
946014444 2:216592743-216592765 TTGACTCAAGGGAGGGAAGCAGG - Intergenic
946722291 2:222622401-222622423 TTGTTTCTGGGGAGGAAAAGAGG + Intronic
947729116 2:232418462-232418484 GTCAATCTAGGGAGGGAGACAGG + Intergenic
948738652 2:240027465-240027487 TTCTAGCTGGGGAGGGAAAACGG - Intergenic
1168950978 20:1802143-1802165 CTGTCTCTAGGAAGGGGAACTGG + Intergenic
1170408501 20:16064469-16064491 TTGGGCCTAGGGAGGCAAACTGG - Intergenic
1171122903 20:22581612-22581634 TTCTATATAAGGAGGAAAACGGG - Exonic
1172957205 20:38769458-38769480 TTGGATCTGGGGAGGGAAGTCGG + Intronic
1173823986 20:46035613-46035635 TTGAATGGAGGGAGGGAAAGGGG + Intronic
1174390464 20:50215829-50215851 TGGTCCCTGGGGAGGGAAACTGG + Intergenic
1175435268 20:58942588-58942610 TTGCCTCTAGGGAGAGGAACTGG - Intergenic
1175506810 20:59491962-59491984 GTGTAGTTGGGGAGGGAAACAGG - Intergenic
1177380207 21:20330926-20330948 GGTTATCTTGGGAGGGAAACTGG - Intergenic
1179430992 21:41321087-41321109 TTGTATTTGGAGAAGGAAACTGG - Intronic
1180476090 22:15708991-15709013 TTCTGTTTAGGGAGGGAACCAGG + Intronic
1180949638 22:19715242-19715264 TTGTGTATGGGGAGGGAAAGGGG - Intronic
1183540861 22:38428562-38428584 TGGAATCCAGGGAGGGAAGCGGG - Intronic
1184491882 22:44814655-44814677 TTGTACCTGAGGAGGGAAACGGG - Exonic
949940209 3:9148910-9148932 TTATTTCTAGGGAATGAAACTGG + Intronic
950292304 3:11795194-11795216 TTGAAGCTAGAGAGGTAAACAGG + Intronic
950435845 3:12979539-12979561 TTGTCTCTGGGGAGGGGAATGGG + Intronic
951059943 3:18194261-18194283 TGATTTCTAGAGAGGGAAACTGG - Intronic
952737000 3:36700753-36700775 CTGTATCTAGGGAGGTACAAAGG + Intergenic
957270700 3:78026751-78026773 TTGCTTCTGGGGAAGGAAACTGG + Intergenic
957878807 3:86183717-86183739 ATGTGTCCAGGGAGGGACACTGG - Intergenic
960140015 3:114142605-114142627 TTGTTTCTAGGGAGGGAGATGGG + Intronic
961187049 3:124924679-124924701 TTGCCTCTGGGGAAGGAAACTGG + Intronic
961611860 3:128145886-128145908 TTATCTCCAGGGAGGGGAACAGG - Intronic
961941326 3:130640041-130640063 TTGTTGCTAGGGTGGGAAAAGGG + Intronic
962753684 3:138452415-138452437 TTGGATCTAGGCAGGAAACCAGG - Intronic
963052650 3:141155020-141155042 TTGGTTCTAGGGAGAAAAACAGG + Intergenic
963766709 3:149343654-149343676 TCGTATCTAGGGAGAAAAACTGG + Intergenic
963812168 3:149788718-149788740 TTGCATCTGGGGAGGGAAACTGG + Intronic
964083135 3:152784871-152784893 TTTTATTTGGGGAGGGAAAAGGG - Intergenic
965562620 3:170076111-170076133 TTGTATCTAGGGAGGGAAACTGG + Intronic
965767754 3:172149128-172149150 TTGTATCAGTGAAGGGAAACAGG - Intronic
966037159 3:175433118-175433140 TTGTGGCTTGGGATGGAAACAGG - Intronic
967724316 3:192847339-192847361 TTGTTTTTAGGGAGGGAATAAGG - Intronic
967963807 3:194945018-194945040 TTGTAGCTGGGGAGGGGAATGGG + Intergenic
970051143 4:11916409-11916431 TTTTATCGGGGGAGGGAGACAGG - Intergenic
972175437 4:36399674-36399696 TTGTTTCCAGTGTGGGAAACTGG - Intergenic
976380618 4:84394497-84394519 GTGAATCTAGGCAGGGAAAGAGG + Intergenic
976966836 4:91053649-91053671 TTGCATCTGGGGATGGAAACTGG - Intronic
977106681 4:92894810-92894832 TTGATTCTCAGGAGGGAAACAGG - Intronic
977854691 4:101875608-101875630 ATGTATCTAGGGGGGGACCCTGG - Intronic
978374092 4:108057067-108057089 CTGCATCTAGGGAGGGGAAGGGG - Intronic
978505429 4:109451221-109451243 CTGTATATAGAGAGGGAGACAGG + Intronic
979497827 4:121404587-121404609 TTGCATCTAGGGAGGGCCTCAGG + Intergenic
983167013 4:164490353-164490375 TTGTATGAAGGGAGTGAAACCGG - Intergenic
983265269 4:165501445-165501467 CTGTCTCTAGGGAGGAAAATGGG - Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985767993 5:1790926-1790948 TGGCTTCTAGGGAGAGAAACTGG + Intergenic
986691150 5:10314969-10314991 ATTTATCTTGGGAGTGAAACTGG + Intergenic
987422769 5:17739882-17739904 TTTTATCTTGGGAAGGAAAGGGG - Intergenic
988433204 5:31143881-31143903 TTGAACCTAGGGAGTGAATCTGG - Intergenic
988452850 5:31360717-31360739 TTGTTTCTTGGGAGAGGAACTGG - Intergenic
990974008 5:61541528-61541550 TTAAATCTGGGGAGGGAAAAAGG + Intronic
992145378 5:73841788-73841810 TTACATCTAGGGAAGGAAATAGG + Intronic
992752150 5:79871656-79871678 CTGCCTCTAGGGAGGGGAACTGG - Intergenic
994554190 5:101276866-101276888 TTATTTCTAGGGAGGAAAATAGG + Intergenic
997430197 5:133832625-133832647 ATGTATGTAGGGAGGAAAGCTGG - Intergenic
997438456 5:133891860-133891882 TTTTATCCTGGGTGGGAAACTGG - Intergenic
997904343 5:137800219-137800241 ATGTATTTGGGTAGGGAAACAGG + Intergenic
999650962 5:153767078-153767100 ATGTATACAGGAAGGGAAACTGG + Intronic
1000178382 5:158781985-158782007 GTGTGCCTAGGAAGGGAAACTGG - Intronic
1000354066 5:160376534-160376556 TTGTCTCTGGAGAGGGGAACTGG + Intergenic
1001644847 5:173272586-173272608 TGGGATCCAGGCAGGGAAACAGG + Intergenic
1002464446 5:179399358-179399380 TGGTATAAAGGGAGGCAAACAGG - Intergenic
1003238534 6:4320452-4320474 TTGTATCCTGAGAGGGAAAGTGG + Intergenic
1003420591 6:5954269-5954291 TTGTCTTTAGGGAGGTGAACTGG + Intergenic
1003420612 6:5954608-5954630 TTGTCTTTAGGGAGGTGAACTGG + Intergenic
1005797673 6:29384411-29384433 TAGTCTCTAGGAAGAGAAACTGG + Intronic
1006732147 6:36244244-36244266 TTTTCTCTAGGAAGGAAAACTGG - Intronic
1007067887 6:39011141-39011163 TTGTTTCTAGTGAGTGAAAGAGG - Intronic
1007249831 6:40488140-40488162 TAGGCTCTTGGGAGGGAAACAGG + Intronic
1007334417 6:41142287-41142309 TTATCTCTGGGGAGGGCAACTGG - Intergenic
1008019658 6:46561672-46561694 TTATATCTAGGTGTGGAAACGGG + Intronic
1009636074 6:66266081-66266103 GTGTGTCTAAGGAGGAAAACAGG - Intergenic
1010641012 6:78327297-78327319 ATGTATTTAAGGAGGGAAACAGG - Intergenic
1012212072 6:96531581-96531603 TTGTTTCTGGGGAAAGAAACTGG + Intronic
1015017556 6:128432576-128432598 TTTTATCTTGGGACTGAAACAGG - Intronic
1015346697 6:132168683-132168705 TTGTCTATGGGGAGGAAAACAGG - Intergenic
1015932630 6:138376664-138376686 ATGTATCAAGGGTGGGATACAGG + Intergenic
1017793286 6:157820453-157820475 TTGTATATAGAGAGAGAGACTGG - Intronic
1018282026 6:162197010-162197032 TTATACCTAAGGAGGAAAACTGG - Intronic
1018609750 6:165636614-165636636 TTGCATTTAGGGTGGGAAGCTGG - Intronic
1018846362 6:167559632-167559654 TTGTCTCCTGGGAGGGGAACTGG - Intergenic
1020335597 7:7059953-7059975 TAATATCCAGGGAGGGAGACAGG - Intergenic
1023105445 7:36759432-36759454 TTGTAGCTGTGGAGGGAAAAGGG - Intergenic
1023319574 7:38978731-38978753 TTGTATCTAGGGAGGTGAGCTGG + Intronic
1024169181 7:46766469-46766491 CTGTACCTAGGCAGGGGAACTGG + Intergenic
1027054602 7:75041336-75041358 TACATTCTAGGGAGGGAAACGGG - Intronic
1027804070 7:82793470-82793492 TTGTCTCCAGGGAGGTGAACTGG - Intronic
1029162111 7:98559926-98559948 TTGTATCTTGGGAGGTAAGAGGG + Intergenic
1029923098 7:104287227-104287249 TTGTATCTAGTGAGGGAGGGAGG - Intergenic
1031893715 7:127324222-127324244 TGGTGTCCAGGGAGGGAATCTGG + Intergenic
1032039817 7:128549965-128549987 TTGTCTCTAGGAAGGAAACCAGG - Intergenic
1032064613 7:128757107-128757129 ATATATATAAGGAGGGAAACAGG - Intronic
1035959332 8:4119588-4119610 TTCTATCTAGGGAGGAGACCAGG + Intronic
1036514167 8:9428460-9428482 TTGTTTCTAGGAAAGAAAACTGG + Intergenic
1036609560 8:10337938-10337960 TTGGAAGTAGGGAGGTAAACTGG + Intronic
1038253883 8:25932300-25932322 TTTTAACTAGGAAAGGAAACAGG + Intronic
1038498755 8:28025907-28025929 TTGCCTCTAAGGAGGGGAACTGG - Intronic
1039647064 8:39298196-39298218 TTGTATATAGTGAGGGATAGGGG + Intergenic
1041020584 8:53634182-53634204 ATGTGTCTAGTGGGGGAAACTGG - Intergenic
1041607194 8:59795699-59795721 TTGTATATAGTGAGAGATACGGG - Intergenic
1047169583 8:122478751-122478773 TTATGTCTGGGGAGGGAAATAGG + Intergenic
1047194643 8:122710553-122710575 TTGGCTCCAGAGAGGGAAACTGG - Intergenic
1047926727 8:129689468-129689490 TTGGCTCTAAGGAGGGAAAAAGG - Intergenic
1048982828 8:139712220-139712242 TTGTCCCTAGGCAGGGAAATGGG + Intergenic
1049979930 9:894654-894676 TTGCACCTTGGGAAGGAAACAGG + Intronic
1050345929 9:4687244-4687266 TTGTATCTAGCTAGAAAAACTGG - Intronic
1050433590 9:5586502-5586524 TTGTATCTAAGGATGGAACAAGG + Intergenic
1050930524 9:11318057-11318079 TTGTATCTTGGGAGGAAAAAAGG + Intergenic
1052211039 9:25903755-25903777 ATGTATCTAGAGAGAGAAAGAGG + Intergenic
1053400893 9:37821013-37821035 TTGCCTTTGGGGAGGGAAACTGG - Intronic
1057905398 9:98978847-98978869 TTGTCTCCAGGGAAGGAAGCTGG - Intronic
1058844941 9:108947517-108947539 TTGGTTCTAGAGAGGCAAACAGG + Intronic
1058847974 9:108980959-108980981 TATAATCTATGGAGGGAAACTGG - Intronic
1059627596 9:116084045-116084067 TTGTTTCTAGGGGAGGAAAATGG + Intergenic
1061286569 9:129626596-129626618 CTGTTTCTCGGAAGGGAAACAGG - Intronic
1061802256 9:133119141-133119163 TGGAAGCTAGGTAGGGAAACAGG + Intronic
1062172890 9:135145150-135145172 TTGTATCTGGGGAGAAAATCTGG + Intergenic
1186070767 X:5817196-5817218 TTGGATCTAGTAAGGGAAAAGGG + Intergenic
1188773704 X:34187065-34187087 TTGTATATAGTGAGAGAAAGGGG + Intergenic
1188870082 X:35361694-35361716 TTGTTTCAAGGGAGGCAAAGGGG - Intergenic
1190850516 X:54235981-54236003 TTGTGTCTAAGGAGAGAACCTGG + Intronic
1192429047 X:71100393-71100415 TTGAATCCAGGGGGGAAAACTGG - Intronic
1192797092 X:74432938-74432960 TGGCCTTTAGGGAGGGAAACAGG - Intronic
1193151449 X:78128842-78128864 TTGCTTCTGGGGAGGGAAACTGG - Exonic
1195281470 X:103338679-103338701 TTTCCCCTAGGGAGGGAAACAGG + Intergenic
1196941533 X:120781315-120781337 TTGCCTCTAGGGATGGAAACTGG - Intergenic
1197134585 X:123046103-123046125 TTGTAACAAGGGATGGAAAATGG + Intergenic
1198253954 X:134908872-134908894 TTGTATCTATGGTGGTAAAATGG - Intronic
1200283171 X:154795826-154795848 TTGCTTCTAGGGAGAGGAACTGG + Intronic
1200385110 X:155882316-155882338 TTGTGTCTAGAGGGGAAAACAGG + Intronic
1200683629 Y:6242442-6242464 ATGTGTCCAGGGAGGGAACCTGG - Intergenic
1200686212 Y:6262734-6262756 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200831884 Y:7693362-7693384 GTGTGTCCAGGGAGGGAACCTGG + Intergenic
1200989094 Y:9333650-9333672 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200991751 Y:9353980-9354002 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200994405 Y:9374260-9374282 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1200997068 Y:9394606-9394628 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200999584 Y:9463144-9463166 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201002242 Y:9483452-9483474 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1201004901 Y:9503739-9503761 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201007559 Y:9524066-9524088 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1201010190 Y:9544256-9544278 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201018464 Y:9626973-9626995 GTGTGTCCAGGGAGGGAAACTGG + Intergenic
1201049006 Y:9911944-9911966 ATGTGTCCAGGGAGGGAACCTGG + Intergenic
1201060421 Y:10038984-10039006 TTGTGCCCAGGGAGGGAAACTGG + Intergenic
1202067587 Y:20956762-20956784 TTTTATGTGGGGAGGGACACTGG + Intergenic
1202115011 Y:21464337-21464359 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202119242 Y:21507662-21507684 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202121694 Y:21531202-21531224 GTGTGTCCAGGGAGGGAACCTGG - Intronic
1202157311 Y:21898180-21898202 GTGTGTCCAGGGAGGGAACCTGG + Intronic
1202159758 Y:21921721-21921743 GTGTGTCCAGGGAGGGAACCTGG + Intergenic
1202161862 Y:21942123-21942145 ATGTGCCCAGGGAGGGAAACTGG + Intergenic
1202229494 Y:22644250-22644272 ATGTGCCCAGGGAGGGAAACTGG - Intergenic
1202313662 Y:23551915-23551937 ATGTGCCCAGGGAGGGAAACTGG + Intergenic
1202557141 Y:26118680-26118702 ATGTGCCCAGGGAGGGAAACTGG - Intergenic