ID: 965564696

View in Genome Browser
Species Human (GRCh38)
Location 3:170102383-170102405
Sequence CTCTAGCCCTTTTGTGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965564696 Original CRISPR CTCTAGCCCTTTTGTGCAAA AGG Intronic
902857352 1:19218127-19218149 CTCTAGCCCTGTGGTGAAAGAGG - Exonic
904371719 1:30051932-30051954 CTGTACCCCTTTTGTGGAAGAGG + Intergenic
905743145 1:40389743-40389765 CTTTAGCCCTTTTGTGGGATGGG + Intronic
907526029 1:55054626-55054648 CTCTGGCCCTGATGTGCAAGGGG - Intronic
909119450 1:71582784-71582806 CTTTAGCCCTGGAGTGCAAATGG - Intronic
911470557 1:98312998-98313020 CTCCATCCCTTTTGTGCCCAGGG - Intergenic
912946869 1:114092711-114092733 CTCTAACCCTTCTGTGAAAGGGG + Intronic
920122219 1:203667251-203667273 CTCTAGCACTTTTTTCCAAAGGG + Intronic
923620686 1:235576874-235576896 CACTTGTGCTTTTGTGCAAATGG + Intronic
924455809 1:244218172-244218194 TTCTAGCCCTTTTGTCAACAGGG + Intergenic
1066817048 10:39432183-39432205 TTTTAGGCCTATTGTGCAAAAGG - Intergenic
1067824003 10:49556586-49556608 CCCCAGTGCTTTTGTGCAAATGG - Intergenic
1070146630 10:73778818-73778840 CTCTTGTTCTTTTCTGCAAAAGG - Intronic
1071544432 10:86517959-86517981 CTCTCCCCATTTTGTGCTAAGGG + Exonic
1075054750 10:119208951-119208973 CTCTTCCCCTTTTATGAAAAAGG - Intronic
1078487749 11:11739809-11739831 TTATATCCCTTTAGTGCAAAAGG - Intergenic
1079136375 11:17778056-17778078 CACAAGCCCTTTTGTGGAAGAGG - Intronic
1079926722 11:26502955-26502977 CTCTACCACTATTTTGCAAATGG + Intronic
1080545094 11:33309229-33309251 CTCAAGTCCATTTATGCAAATGG + Intronic
1080928829 11:36785900-36785922 AACTAGTCCTTTTGTACAAATGG + Intergenic
1082257236 11:50044407-50044429 CCGTAGCCCTCTTGTGCATAAGG + Intergenic
1088672000 11:112150914-112150936 CTCTCTCCCTTTTGTCCCAAGGG + Intronic
1093915597 12:24799178-24799200 CTCAAGCCCTTTAGTGAAAGAGG + Intergenic
1093923746 12:24888971-24888993 CCCTAATCCTTTTATGCAAATGG - Intronic
1094490015 12:30954338-30954360 TTCTAGCCCTGCTGTACAAAGGG + Intronic
1095700955 12:45190484-45190506 CTCTAGCTCTTTTGTCTAAGAGG + Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1106017542 13:25883980-25884002 TTTTATCCCTTTTGTGCACATGG + Intronic
1108532921 13:51344331-51344353 CTGCAGCCTTTTTGTGCAAGTGG + Exonic
1109109416 13:58297058-58297080 CTCTTCCTCATTTGTGCAAAGGG + Intergenic
1109888532 13:68575696-68575718 CTGGAGCCCTTTTGTTAAAAAGG - Intergenic
1110041352 13:70763295-70763317 TTCTAGCCCTATTATGTAAAGGG + Intergenic
1110469481 13:75842741-75842763 TTCTAGCCTCTTTATGCAAATGG - Intronic
1111346416 13:86960901-86960923 TTCTAGACATTTTGTACAAATGG + Intergenic
1111495358 13:89041887-89041909 CTCTACCTCTTTTGAGCATAGGG - Intergenic
1111790897 13:92852998-92853020 CTCTAACTCTGATGTGCAAATGG - Intronic
1114036517 14:18634828-18634850 TTCTAGCCCATTTTTGCAAAGGG + Intergenic
1114122116 14:19680209-19680231 TTCTAGCCCATTTTTGCAAAGGG - Intergenic
1114675756 14:24439282-24439304 CTTCTGCCCTTTTGTGCTAAGGG + Exonic
1117758493 14:59001047-59001069 CTCTAGCAATCTTGGGCAAAAGG + Intergenic
1121663681 14:95655122-95655144 CTCTGGCCACTTTGTGAAAAAGG + Intergenic
1124618090 15:31256945-31256967 CTCTAGCCCAGTGGTGCAATGGG + Intergenic
1131696382 15:94881828-94881850 CTCTAGCCATTATGTGGGAATGG - Intergenic
1134046514 16:11104837-11104859 CTCTACCCCATTTGTGCCTAGGG - Intronic
1134118335 16:11566062-11566084 CTCTGGTCCTTTTTTGCAAATGG - Intronic
1136916862 16:34212721-34212743 TTTTAGCCCTTTGGTGGAAAAGG - Intergenic
1139784675 16:69383137-69383159 CTATAGCCCTTGTGTTCTAAAGG + Intronic
1140596488 16:76421116-76421138 TTCAAACCCTTTTATGCAAAAGG + Intronic
1141547318 16:84779187-84779209 TTCTAGCCCATTTTTGCAAAGGG - Exonic
1145933704 17:28703068-28703090 TTGTAGCCCTTTTGTGCTGAAGG - Intergenic
1148704554 17:49617976-49617998 CGCTAGGCCTTTTCTGCAAAAGG + Intronic
1149433756 17:56616541-56616563 CTCAAGCCCTTTTGTGAACTTGG - Intergenic
1149781781 17:59403345-59403367 CTCTCGTCCTTCTCTGCAAAAGG - Intergenic
1150486921 17:65550399-65550421 CTCCAGCCCTTTTGTTTCAATGG + Intronic
1157710092 18:49844154-49844176 CTTTGGCCCTTTCTTGCAAAAGG + Intronic
1159859052 18:73625580-73625602 CTCTAGCCGTTTTGGGCAGTTGG - Intergenic
1161460900 19:4396899-4396921 CCCTAATCCTTTTGTGTAAAAGG + Intronic
1161941512 19:7407565-7407587 CTCTATCCCTGATGTGCAGAAGG - Intronic
1166275417 19:41750299-41750321 CTCCAGCCCTTGTTTGGAAATGG - Intronic
1166280442 19:41789096-41789118 CTCCAGCCCTTGTTTGGAAATGG - Intergenic
1166396299 19:42443684-42443706 CTCCAGCCCTTGTTTGGAAATGG + Intergenic
925977786 2:9153142-9153164 CTGAAGCCCTCTTCTGCAAATGG - Intergenic
931471819 2:62545653-62545675 ATCTGACCTTTTTGTGCAAATGG + Intergenic
939047018 2:137261663-137261685 CTCTATCTCTTTTATGCATAAGG - Intronic
940638495 2:156325828-156325850 CTGTAGCCCCTGTGTGCAAAGGG + Exonic
941275505 2:163485703-163485725 CTCTGGCCCTCTTGGGGAAAAGG - Intergenic
944664666 2:201949905-201949927 CTATGGCCCTTTTCTGCAGAAGG + Intergenic
945511539 2:210708897-210708919 CTCTATCCCTTTTTTAAAAAGGG + Intergenic
947469831 2:230390954-230390976 TTCTAGGCATTTTCTGCAAATGG + Intronic
948509480 2:238454005-238454027 CTCTAGTCCTTTTATTTAAAAGG - Intergenic
1169716754 20:8628130-8628152 CTCTAGGCCATTTGTGGAATGGG + Intronic
1180460642 22:15561885-15561907 TTCTAGCCCATTTTTGCAAAGGG + Intergenic
950289955 3:11775476-11775498 CTCCAACACTTGTGTGCAAATGG + Intergenic
951340639 3:21482441-21482463 CTCTAAACCTTTTCTGTAAAAGG - Intronic
954667185 3:52262177-52262199 TTCTAGACATTTTGTGTAAATGG - Intronic
955773943 3:62414294-62414316 CTGTTGCCCTTTTGGGCAACTGG - Intronic
956245955 3:67183373-67183395 ATCTAGCCCTTTAGAGAAAAAGG - Intergenic
958199673 3:90294993-90295015 TTCTAGGCCTATTGTGAAAAAGG - Intergenic
958683827 3:97366809-97366831 CTCTCGCCCTTGTTTGAAAACGG + Intronic
958901896 3:99896973-99896995 CTCTAGCACTTTTCTCCAATTGG - Intronic
960620758 3:119634808-119634830 CTCTATCCTTTTTGGGCAATAGG - Intergenic
961924700 3:130465400-130465422 TCCTAGCCCTGTTGAGCAAATGG - Intronic
964213081 3:154249774-154249796 CTCTTGTCACTTTGTGCAAAGGG + Intronic
965564696 3:170102383-170102405 CTCTAGCCCTTTTGTGCAAAAGG + Intronic
973123955 4:46560095-46560117 CTCTGGGGCTTTTATGCAAATGG + Intergenic
974871666 4:67651841-67651863 TTCTAGCCCATTTGTTGAAAAGG - Intronic
982678356 4:158401249-158401271 CTCTATCTCTTATGAGCAAATGG - Intronic
983373137 4:166889989-166890011 CTCTAATCCTCGTGTGCAAATGG + Intronic
984182744 4:176504942-176504964 TTTTACCCCTTTTGTGCACAAGG + Intergenic
987574893 5:19712428-19712450 CAGTAGCCCTTTTGTTCATATGG - Intronic
991123869 5:63047837-63047859 CTCTTGCTTTTTTGAGCAAAAGG + Intergenic
993016830 5:82544208-82544230 CTCTAGGCCTTTGATGGAAAAGG - Intergenic
993487379 5:88503522-88503544 CTCTTGCCCTGTTATGTAAATGG + Intergenic
994009677 5:94886131-94886153 CTATAGGCTTTTTGTGGAAAGGG + Intronic
999088327 5:148912780-148912802 CTCTCACCCTGTTGTGCTAAGGG - Intergenic
1000297140 5:159921785-159921807 CTCCAGCCCTTTCATTCAAATGG + Intronic
1000947826 5:167443465-167443487 CAGTAACCCTTTTCTGCAAAGGG - Intronic
1001447520 5:171797312-171797334 CTCCAGACCCTTTCTGCAAAGGG - Intergenic
1002053109 5:176583028-176583050 CTCTGACCCTTGTGTGAAAATGG - Intronic
1003794579 6:9586645-9586667 CTTTAGCACCCTTGTGCAAATGG - Intergenic
1003992292 6:11498244-11498266 CTCTAGCCTTTTTGTGCTTCAGG + Intergenic
1004437490 6:15610574-15610596 ACCTAACCATTTTGTGCAAAAGG - Intronic
1007335950 6:41155233-41155255 TTCTAGTCCTTCTGTGCAAAGGG + Intergenic
1012011636 6:93795069-93795091 CTCTAGCCCTTTACTTCTAATGG + Intergenic
1018922897 6:168188014-168188036 CCCTAGACTTTATGTGCAAAAGG + Intergenic
1020447267 7:8282377-8282399 CTTTGGCCCTTGTGAGCAAATGG + Intergenic
1021733313 7:23618373-23618395 CTCTAGATATTTTGTGCTAATGG - Intronic
1022599163 7:31740118-31740140 TTCTAGCCCTTCAGAGCAAAAGG - Intergenic
1023117343 7:36875329-36875351 CTCTAGCACATATGTGCAGAAGG + Intronic
1025311842 7:57955811-57955833 TTCCAGGCCTGTTGTGCAAAAGG - Intergenic
1025315516 7:58021324-58021346 TTCTAGGCCTTTTGTAGAAAAGG + Intergenic
1026623337 7:71970755-71970777 CTTGAGCCCTTTTGTGAATAAGG - Intronic
1027270454 7:76515777-76515799 CTCCAACCCTCTTGTGCATATGG + Intronic
1029032443 7:97483032-97483054 CTCTAGAAGTTCTGTGCAAATGG - Intergenic
1032184901 7:129716338-129716360 CTCTAGACCCTTTGTCCAAAGGG - Intronic
1034031786 7:147774670-147774692 CTCTCTCCCTTATGTGCAGATGG - Intronic
1036189398 8:6656621-6656643 CTGTAGGTCTGTTGTGCAAAAGG - Intergenic
1036597164 8:10224435-10224457 ATCAAGCTCTTTTGTGAAAAAGG - Intronic
1040142115 8:43932790-43932812 TTTTAGGCCTTTGGTGCAAATGG + Intergenic
1041927324 8:63250241-63250263 CTCTAGCCCTCTTGTCTAAACGG + Intergenic
1044523984 8:93230793-93230815 TTTTAGCTCATTTGTGCAAATGG - Intergenic
1048638845 8:136330250-136330272 CTCTTGCCCATTTGTCCACATGG - Intergenic
1050992241 9:12169392-12169414 CCATAGCCCTTTTATGCACAAGG - Intergenic
1058670907 9:107359740-107359762 CTGAAGCTCTTTTGTGCTAATGG + Intergenic
1059751629 9:117253227-117253249 CTGTAGCCCCTTTGAACAAATGG - Intronic
1061859786 9:133462061-133462083 CTCCAGCCCTTTATTGCTAAAGG + Intronic
1188793422 X:34433792-34433814 CTCTAGCCATTTTGGTGAAATGG + Intergenic
1191266076 X:58395255-58395277 CTGGAGGCCTTTTGTGTAAAAGG + Intergenic
1193761741 X:85475632-85475654 CTATAGCCATTTTGAGGAAAGGG - Intergenic
1194409014 X:93534013-93534035 CAATAGCCCTTGTGTGCCAAAGG + Intergenic
1195004665 X:100673945-100673967 TTCTTGACCTCTTGTGCAAAAGG - Intergenic
1197162620 X:123340957-123340979 CTCAAGCTCTTTTCAGCAAAGGG + Intronic
1198966669 X:142235138-142235160 TCCTTACCCTTTTGTGCAAAAGG + Intergenic
1201963776 Y:19709527-19709549 CTCCAGCCCTTCTGTGGACAAGG - Exonic