ID: 965565146

View in Genome Browser
Species Human (GRCh38)
Location 3:170107966-170107988
Sequence ATGTGTGCCCAAAAGGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965565143_965565146 2 Left 965565143 3:170107941-170107963 CCCAAAGAATTGAAGTGGCAATT 0: 1
1: 0
2: 1
3: 22
4: 278
Right 965565146 3:170107966-170107988 ATGTGTGCCCAAAAGGTAGTAGG 0: 1
1: 0
2: 0
3: 16
4: 128
965565144_965565146 1 Left 965565144 3:170107942-170107964 CCAAAGAATTGAAGTGGCAATTA 0: 1
1: 0
2: 1
3: 11
4: 176
Right 965565146 3:170107966-170107988 ATGTGTGCCCAAAAGGTAGTAGG 0: 1
1: 0
2: 0
3: 16
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965565146 Original CRISPR ATGTGTGCCCAAAAGGTAGT AGG Intronic
901453711 1:9351730-9351752 AGGTGTGAACAAAAGGAAGTTGG + Intronic
907883858 1:58576039-58576061 GTGTGTGCGCAAAAGGGAGGGGG + Exonic
911349770 1:96739069-96739091 ATGTGTCCCCAAAAGCTGGAGGG + Intronic
913656510 1:120965584-120965606 ATATGTGCCCAAAAGCTAATAGG - Intergenic
914521062 1:148416815-148416837 ATATATGCCCAAAAGCTAGTAGG - Intergenic
914646470 1:149657313-149657335 ATATGTGCCCAAAAGCTAATAGG - Intergenic
915455750 1:156039593-156039615 ATGTTTGCCCAAGGGGTATTTGG + Intronic
915518187 1:156425820-156425842 ATGTGGGCAGAAAAGGTAGGAGG + Intronic
915856637 1:159395653-159395675 AAGTGTGCTCAAAGAGTAGTGGG + Intergenic
916201621 1:162276989-162277011 ATGTAAGTCCAAAAGGTATTTGG - Intronic
917338712 1:173951904-173951926 ATTTGTGCCTAAATGGTAATGGG + Intronic
918841332 1:189543357-189543379 ATGTGTGCCCACAAAGGAGCAGG + Intergenic
921222563 1:212983584-212983606 ATGTGTCCCCAAAAGTTCATGGG - Intronic
923680009 1:236111564-236111586 ATCTTTGCCCATCAGGTAGTTGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1067054944 10:43044957-43044979 TTGTGTGCCAGAAAGGCAGTGGG + Intergenic
1071319914 10:84444218-84444240 TTGTGTGCCATAAAGGTAGCTGG + Intronic
1071353028 10:84765718-84765740 CTGTGAGCCCAAAAGCTAATAGG - Intergenic
1072414115 10:95232586-95232608 CTGTGTCCCCAAGAGGTAGACGG - Intergenic
1074449092 10:113544790-113544812 ATGTTTGATCAAAAGATAGTAGG - Intergenic
1074450411 10:113554934-113554956 ATGTGTGCCAGACAGGTGGTCGG + Intronic
1077584924 11:3443916-3443938 ATGTGTCCCCAAAAGGCACTGGG + Intergenic
1078891547 11:15562470-15562492 ATGTATGCTCACAAGGTACTAGG - Intergenic
1080703076 11:34661734-34661756 ATGTGTCCCCAAAAGAAAGGAGG - Intergenic
1080738500 11:35041162-35041184 ATGTGTGCTTAAAGGGAAGTGGG + Intergenic
1082120013 11:48370061-48370083 ATCTGTGACCAAAAGGTTGGGGG + Intergenic
1084241824 11:67826483-67826505 ATGTGTCCCCATAAGGCACTGGG + Intergenic
1084830515 11:71765370-71765392 ATGTGTCCCCAAAAGGCACTGGG - Intergenic
1085861123 11:80237271-80237293 ATGTGTGCAGAAATGATAGTAGG - Intergenic
1087176617 11:95102195-95102217 ATGTGAGGCCAAATGGCAGTAGG - Intronic
1091769958 12:3145103-3145125 CTGTGTGCTCACAAGGGAGTGGG - Intronic
1092971255 12:13697422-13697444 AGGTGTTCCCAAAAGCTAGTAGG - Intronic
1093070355 12:14701874-14701896 ATGTGTCCTCAAATGGTAGGGGG - Intergenic
1096230255 12:49892796-49892818 ATGTCTGCCCAGTAGGCAGTTGG - Intronic
1098535780 12:71592183-71592205 ATGTGTGCTCACATGGTAGAAGG - Intergenic
1099603895 12:84777481-84777503 ATGTGTCCTCAAAAAATAGTAGG + Intergenic
1102409099 12:112701589-112701611 ATGTTTGCCAAAAATGGAGTGGG + Intronic
1104025516 12:125023373-125023395 ATGTGTTCCCTAAAAGTAGCAGG - Intronic
1104216015 12:126734678-126734700 ATGTGTGCAGAAAAGGATGTAGG - Intergenic
1106648365 13:31661848-31661870 ATTTTTGCCCAAAAGTTATTCGG + Intergenic
1107117303 13:36761097-36761119 ATATGTGCCCCCAAGGTGGTTGG + Intergenic
1107538792 13:41365122-41365144 ATGTTTGGCCAAAAGGTACAGGG + Intronic
1107750199 13:43557276-43557298 ATGTATGGCCAGAAGGTGGTAGG + Intronic
1112865446 13:103890764-103890786 GTATGTGGCCAAAAGTTAGTTGG - Intergenic
1113309751 13:109119763-109119785 ATGTTTGCACAAACAGTAGTAGG - Intronic
1116625292 14:47255364-47255386 CTGTGTGCCTTACAGGTAGTGGG + Intronic
1118984228 14:70739820-70739842 ATATGTGACTAAAAGGTAGAGGG + Intronic
1120650419 14:87125349-87125371 ATGTGTGCATAAAAGACAGTAGG - Intergenic
1120898916 14:89558899-89558921 AAGTGTGCCCAAATGTGAGTGGG - Intronic
1122705271 14:103616968-103616990 ATATGTGCCCAAAATGTGGAGGG - Intronic
1133555341 16:6901397-6901419 TTGTCTTCCCCAAAGGTAGTAGG - Intronic
1135617148 16:23921210-23921232 ATGTGTGCCCAAGTAGTAGAGGG + Intronic
1138953743 16:61945769-61945791 ATATGTTGCTAAAAGGTAGTGGG + Intronic
1144118656 17:12127827-12127849 ATGTGTGCACAAAAGTAAGCAGG - Intronic
1148181572 17:45609418-45609440 ATTTTTGCAAAAAAGGTAGTTGG - Intergenic
1148267278 17:46236275-46236297 ATTTTTGCAAAAAAGGTAGTTGG + Intergenic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1153341606 18:3980445-3980467 ATTTGTGTCCAAAATGAAGTGGG + Intronic
1157339439 18:46766334-46766356 ATGTATGTCAAAGAGGTAGTTGG + Intergenic
1157523992 18:48364785-48364807 ATTTGTGCACAAAAGGTAAAAGG - Intronic
1158757094 18:60338342-60338364 ATTTATGCTAAAAAGGTAGTTGG + Intergenic
1160390114 18:78523688-78523710 GTGTGTGCCTCAAAGCTAGTGGG + Intergenic
1167392655 19:49206395-49206417 ATGTCTGTCAAAAAGGTTGTTGG + Intronic
926636457 2:15185052-15185074 ATGTATCTCCCAAAGGTAGTAGG + Intronic
927697093 2:25246152-25246174 ATGAGCGCACAAGAGGTAGTTGG - Exonic
928898152 2:36288486-36288508 ATGTATGTCCAAAAGAAAGTTGG + Intergenic
931224313 2:60316433-60316455 ATGTCTGCCCAAAGGACAGTTGG - Intergenic
932461109 2:71882631-71882653 ATGTGAGCCTAAAAGGAAGATGG + Intergenic
933113849 2:78441087-78441109 ATGAGTACTCAAAAGGTAGGTGG + Intergenic
935551430 2:104461579-104461601 ATGTGTGCCGAAGGGGTAGGGGG - Intergenic
940229749 2:151438067-151438089 ATCTCTGCCCCAAAAGTAGTGGG + Intronic
942691285 2:178587952-178587974 GTGTGTGCCCAAAACCAAGTTGG - Exonic
943659397 2:190542181-190542203 ATGTGTGTTCAAGAGGGAGTTGG - Intergenic
944135507 2:196394987-196395009 ATGTGTGCCCACTTGGTAGAAGG + Intronic
946356747 2:219190912-219190934 ATGTGTCCTCAAATGGTAGAAGG - Intergenic
1173330395 20:42071374-42071396 ATATGAGCCCAAAAGGAACTGGG - Intergenic
1174364774 20:50049946-50049968 ATGGCTGCCCTGAAGGTAGTGGG - Intergenic
1175786124 20:61712694-61712716 ATGAGTGCCCAGAAGGCAGCAGG + Intronic
1177356054 21:20009196-20009218 ATGTGTCCCCAAAAAGTTGAGGG - Intergenic
1180154803 21:45972674-45972696 TTCTGGGCCCAAAAGGTCGTGGG - Intergenic
1180938674 22:19642430-19642452 ATCTGTTCCCAAAAGGAGGTGGG - Intergenic
951069042 3:18304048-18304070 ATTTGTGACCAAGAGGTAGGAGG + Intronic
957057283 3:75453400-75453422 GTGTGTCCCCAAAAGGCACTGGG + Intergenic
958866932 3:99511662-99511684 ATGTGTGCCCATGAGGAAATGGG + Intergenic
959572058 3:107895359-107895381 ATGTGTGCCCATAAGGTCTCTGG + Intergenic
959912347 3:111778047-111778069 ATGAGTGCCCAAGGGGCAGTAGG - Intronic
960482550 3:118211479-118211501 ACGTTTGCCCAAAAGGAGGTGGG + Intergenic
961296169 3:125886335-125886357 ATGTGTCCCCAAAAGGCACTGGG - Intergenic
961889632 3:130119841-130119863 ATGTGTCCCCAAAAGGCACTGGG + Intergenic
963826779 3:149964220-149964242 AGGGGTGCTCAAAAGTTAGTAGG - Intronic
965565146 3:170107966-170107988 ATGTGTGCCCAAAAGGTAGTAGG + Intronic
966623584 3:181992492-181992514 ATTTGTCCACAAAAGGTATTGGG - Intergenic
969000121 4:3973759-3973781 ATGTGTCCCCAAAAGGCACTGGG + Intergenic
969753901 4:9134848-9134870 ATGTGTCCCCAAAAGGCACTGGG - Intergenic
969813791 4:9671044-9671066 ATTTGTTCCCAAAAGGCACTGGG - Intergenic
975890068 4:79017020-79017042 ATGTGGGCCTAAGAGGGAGTGGG - Intergenic
980777024 4:137450917-137450939 ATGTGTGCCCAAACTGTTTTAGG - Intergenic
981331703 4:143516642-143516664 ATCTGTGACCAAAAAGTTGTGGG - Intronic
986326974 5:6683297-6683319 CTCTGTGTCCAAAAGGTAGAAGG - Intergenic
988014266 5:25532062-25532084 ATGGGTGCAGAAAAGGTATTTGG - Intergenic
990027878 5:51217930-51217952 AAGTGTGCCCATAAAGTAATGGG - Intergenic
991185831 5:63805894-63805916 ATGGGTGCCCAGTAGATAGTAGG - Intergenic
992081893 5:73241365-73241387 ATGGGTGCTGAAAAGGTGGTAGG + Intergenic
992881172 5:81111927-81111949 AAGTGTGCATAAAAAGTAGTGGG - Intronic
993479631 5:88408333-88408355 ATGTGTGACAAAAACGGAGTGGG + Intergenic
996907155 5:128614120-128614142 TTGTGTCCCCAAAATGTATTAGG + Intronic
999471616 5:151859714-151859736 GTCTATGCCCAGAAGGTAGTGGG + Intronic
999944754 5:156582760-156582782 GTGTGTGTCCAAAGGATAGTGGG - Intronic
1000244856 5:159440888-159440910 AGGTGTCTCCAAAAGGTTGTTGG + Intergenic
1001717340 5:173827118-173827140 ATGTGTGCTGAAAAAGTTGTTGG - Intergenic
1011231787 6:85169983-85170005 AAGGGTGCACAAAAGGTGGTAGG + Intergenic
1016453647 6:144209614-144209636 ATGTGTACACACAAGGTGGTGGG + Intergenic
1016546512 6:145229937-145229959 ATTTGTGCCCAAAAGCAAATGGG - Intergenic
1020732840 7:11905882-11905904 ATTTGGGCCCAAAAGGAATTAGG - Intergenic
1021132373 7:16926709-16926731 ATGTGTGGCTAAAAGGCATTTGG + Intergenic
1023336947 7:39180436-39180458 CTGTGTGCCCAAGAAGTGGTGGG - Intronic
1023659472 7:42457696-42457718 GTGTGTTCCCAAAACGTATTTGG + Intergenic
1025996655 7:66531565-66531587 GTGTTTGCCCAAAAGGGAGCTGG - Intergenic
1027453506 7:78359370-78359392 ATGTGTGACCAAGAGGTGGCAGG + Intronic
1028111016 7:86941446-86941468 ATGTGTGGCAAATAGGTAGGAGG + Intronic
1028188119 7:87813586-87813608 TTTTGTGCCCAATAGGTAGGAGG - Intronic
1036377116 8:8210197-8210219 ATGTGTCCCAAAAAGGCAATGGG - Intergenic
1036852431 8:12212952-12212974 ATGTGTCCCCAAAAGGCACTGGG + Intergenic
1036873799 8:12455475-12455497 ATGTGTCCCCAAAAGGCACTGGG + Intergenic
1041185342 8:55294396-55294418 GTGTGTGCTGAAAAGGTGGTAGG - Intronic
1041870912 8:62633634-62633656 CTTTGTTCCCAAAAGGTTGTGGG - Intronic
1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG + Intronic
1043486898 8:80706614-80706636 TTGTGTGCCACAAAGGCAGTGGG + Intronic
1045763739 8:105642887-105642909 ATGTGTGCCTAAAAGCTCCTAGG + Intronic
1046130334 8:109959788-109959810 TTGTGTGCCAAAAAGTTAGCCGG + Intergenic
1048020574 8:130535275-130535297 ATGTTTGCCCAAAGGGAAGCTGG - Intergenic
1048807982 8:138258536-138258558 ATGCGTGCTCAGAAGGTAGTTGG - Intronic
1054857459 9:69916229-69916251 ATATTTGGCCAAAAGGAAGTGGG + Intergenic
1057227219 9:93298705-93298727 CTGTGTGCCCTGAAGGTTGTGGG - Intronic
1060773189 9:126347455-126347477 ATATATGCCCAAAACGTAGTAGG + Intronic
1185697877 X:2209005-2209027 CTGTGTGCTCACAAGGCAGTGGG + Intergenic
1186995613 X:15118287-15118309 ATGTGTGGACCAAAGGTGGTTGG - Intergenic
1193686234 X:84580196-84580218 ATATGTCCCCAAAATCTAGTTGG - Intergenic
1194874741 X:99173147-99173169 GTGTGTGCCCACAAGGTGGCAGG + Intergenic
1196829323 X:119763770-119763792 AAGTTTAGCCAAAAGGTAGTTGG + Intergenic
1197339954 X:125255361-125255383 ATGTGTGCCTAGAGAGTAGTAGG - Intergenic
1198775354 X:140173216-140173238 ATGTGAGCCCAAAATCCAGTAGG - Intergenic
1199751248 X:150821133-150821155 ATTTCTGCACAAAAGGCAGTTGG - Intronic
1200683145 Y:6236326-6236348 AAGTGTGGCCAAATGGAAGTGGG - Intergenic
1201049487 Y:9918060-9918082 AAGTGTGGCCAAATGGAAGTGGG + Intergenic